Incidental Mutation 'R7709:Dock5'
ID 594496
Institutional Source Beutler Lab
Gene Symbol Dock5
Ensembl Gene ENSMUSG00000044447
Gene Name dedicator of cytokinesis 5
Synonyms 1110060D06Rik, rlc, lr2
MMRRC Submission 045768-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.346) question?
Stock # R7709 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 67989584-68170891 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 68033454 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 972 (Y972H)
Ref Sequence ENSEMBL: ENSMUSP00000036674 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039135]
AlphaFold B2RY04
Predicted Effect probably benign
Transcript: ENSMUST00000039135
AA Change: Y972H

PolyPhen 2 Score 0.445 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000036674
Gene: ENSMUSG00000044447
AA Change: Y972H

DomainStartEndE-ValueType
SH3 11 68 1.45e-13 SMART
Pfam:DOCK_N 71 434 9e-110 PFAM
Pfam:DOCK-C2 439 636 1.1e-57 PFAM
low complexity region 752 764 N/A INTRINSIC
Pfam:DHR-2 1133 1635 6.4e-99 PFAM
low complexity region 1663 1692 N/A INTRINSIC
low complexity region 1815 1824 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the dedicator of cytokinesis protein family. Members of this family act as guanine nucleotide exchange factors for small Rho family G proteins. The protein encoded by this gene is thought to associate with adaptors CRK and CRKL, and function in regulation of intestinal epithelial cell spreading and migration on collagen IV. Similar proteins in mouse and zebrafish also function in myoblast fusion. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mutations at this locus result in lens abnormalities involving cataracts and rupturing of the lens nucleus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A G 3: 124,201,334 (GRCm39) I443T probably damaging Het
2310002L09Rik A G 4: 73,861,091 (GRCm39) C170R possibly damaging Het
4933415A04Rik GTGTGTGTGTATGTGTGTGT GTGTGTGTGT 11: 43,478,237 (GRCm39) probably null Het
A2m A C 6: 121,637,063 (GRCm39) T809P possibly damaging Het
Abca12 T C 1: 71,374,887 (GRCm39) D340G probably benign Het
Abcg8 A T 17: 84,999,919 (GRCm39) D191V probably damaging Het
Acan G T 7: 78,739,356 (GRCm39) V255F probably damaging Het
Ace G A 11: 105,879,663 (GRCm39) V1248I probably benign Het
Adgre1 A T 17: 57,709,519 (GRCm39) Q87L unknown Het
Adgrl1 G A 8: 84,665,617 (GRCm39) V1435M probably benign Het
Ano8 T C 8: 71,934,933 (GRCm39) D423G probably damaging Het
Aox3 T C 1: 58,219,810 (GRCm39) Y1137H probably damaging Het
Arl5a T C 2: 52,295,068 (GRCm39) D114G probably benign Het
B3galt9 T G 2: 34,728,437 (GRCm39) C79G probably damaging Het
Baiap2l2 G T 15: 79,143,911 (GRCm39) N394K probably benign Het
Cap1 A T 4: 122,756,467 (GRCm39) C355S probably damaging Het
Ccdc25 A T 14: 66,077,933 (GRCm39) D22V probably damaging Het
Ceacam2 T C 7: 25,238,076 (GRCm39) D116G probably damaging Het
Clec4b2 A G 6: 123,149,974 (GRCm39) probably benign Het
CN725425 C A 15: 91,124,930 (GRCm39) R157S probably benign Het
Coq8b T C 7: 26,949,962 (GRCm39) I347T probably damaging Het
Ctbp2 C A 7: 132,591,789 (GRCm39) V338L probably benign Het
Cyp2d22 A G 15: 82,258,612 (GRCm39) V83A possibly damaging Het
Daam1 G A 12: 72,024,423 (GRCm39) R797H probably benign Het
Dab1 C A 4: 104,577,756 (GRCm39) S275* probably null Het
Dgkz T C 2: 91,767,404 (GRCm39) E863G probably benign Het
Dhx34 G A 7: 15,946,789 (GRCm39) A515V possibly damaging Het
Dnah14 T C 1: 181,530,049 (GRCm39) probably null Het
Dnmt3b C A 2: 153,514,140 (GRCm39) N384K probably benign Het
Etv5 A T 16: 22,231,597 (GRCm39) Y138* probably null Het
Fdps A G 3: 89,008,397 (GRCm39) S4P probably damaging Het
Gart A G 16: 91,419,853 (GRCm39) F885L possibly damaging Het
Gm32687 A T 10: 81,715,328 (GRCm39) H240L probably damaging Het
Gm4553 C T 7: 141,719,384 (GRCm39) G15R unknown Het
Gm572 C T 4: 148,753,408 (GRCm39) T351M probably damaging Het
Gpr3 A T 4: 132,937,748 (GRCm39) L308Q probably damaging Het
Gpsm2 A G 3: 108,609,097 (GRCm39) V174A probably benign Het
Gucy1a1 T C 3: 82,002,096 (GRCm39) H661R unknown Het
Heatr4 A T 12: 84,004,499 (GRCm39) M774K probably damaging Het
Hmgcr A G 13: 96,799,605 (GRCm39) I163T possibly damaging Het
Ift81 C T 5: 122,747,394 (GRCm39) V91M probably damaging Het
Igsf10 G T 3: 59,238,964 (GRCm39) Q406K probably damaging Het
Il10ra A G 9: 45,171,697 (GRCm39) V257A probably benign Het
Ina A T 19: 47,012,082 (GRCm39) K500I Het
Lce1i A T 3: 92,685,066 (GRCm39) C37S unknown Het
Lrrc59 A T 11: 94,525,811 (GRCm39) D133V probably damaging Het
Magi3 A G 3: 103,941,354 (GRCm39) I867T probably damaging Het
Mmaa T A 8: 79,995,830 (GRCm39) R298W probably damaging Het
Mon1a G T 9: 107,777,327 (GRCm39) V77F probably benign Het
Mrc2 A G 11: 105,237,285 (GRCm39) T1030A probably benign Het
Mrps27 T A 13: 99,541,504 (GRCm39) S162T probably benign Het
Mtmr12 T A 15: 12,245,097 (GRCm39) M204K probably damaging Het
Mtus1 A G 8: 41,507,687 (GRCm39) I21T possibly damaging Het
Myh2 T C 11: 67,085,690 (GRCm39) V1844A probably benign Het
Myh7 C G 14: 55,226,258 (GRCm39) D461H probably damaging Het
Nbr1 T G 11: 101,447,067 (GRCm39) F18V probably damaging Het
Npy2r T C 3: 82,447,689 (GRCm39) N362S probably benign Het
Ocln T A 13: 100,676,106 (GRCm39) Y129F probably damaging Het
Or2t1 T C 14: 14,328,384 (GRCm38) I91T probably damaging Het
Or4c10 T C 2: 89,760,225 (GRCm39) I24T probably benign Het
Or8c20 A G 9: 38,260,573 (GRCm39) M59V probably benign Het
Pik3c2b T G 1: 133,007,579 (GRCm39) probably null Het
Prss39 A G 1: 34,541,709 (GRCm39) D262G probably damaging Het
Ptk7 T A 17: 46,882,569 (GRCm39) D886V possibly damaging Het
Ptprg T A 14: 12,226,452 (GRCm38) D1348E probably damaging Het
Rabgap1 T C 2: 37,427,339 (GRCm39) I640T possibly damaging Het
Rogdi A G 16: 4,827,098 (GRCm39) Y303H probably damaging Het
Rps6kb1 A T 11: 86,404,148 (GRCm39) M283K probably damaging Het
Sardh T A 2: 27,131,529 (GRCm39) T188S possibly damaging Het
Sebox A G 11: 78,394,919 (GRCm39) E87G probably damaging Het
Smchd1 A T 17: 71,665,193 (GRCm39) M1830K probably damaging Het
Spata31h1 A C 10: 82,126,366 (GRCm39) S2215A possibly damaging Het
Spink8 G A 9: 109,645,848 (GRCm39) V7I probably benign Het
Src G A 2: 157,299,164 (GRCm39) V54M probably benign Het
Taar2 A G 10: 23,816,621 (GRCm39) I54V probably benign Het
Tpo A T 12: 30,181,859 (GRCm39) V12E possibly damaging Het
Txk T C 5: 72,864,918 (GRCm39) D373G probably damaging Het
Ubr5 G A 15: 37,980,076 (GRCm39) A2434V probably null Het
Vil1 C T 1: 74,465,754 (GRCm39) T515M probably benign Het
Wdr47 G T 3: 108,525,837 (GRCm39) C120F probably damaging Het
Ylpm1 C T 12: 85,059,799 (GRCm39) P335L unknown Het
Zfp148 T A 16: 33,288,545 (GRCm39) I220N probably damaging Het
Zfp992 A T 4: 146,551,622 (GRCm39) K448* probably null Het
Zfp994 T C 17: 22,419,406 (GRCm39) I514M probably benign Het
Zp2 A T 7: 119,734,998 (GRCm39) I429N probably damaging Het
Other mutations in Dock5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Dock5 APN 14 68,024,338 (GRCm39) splice site probably benign
IGL00930:Dock5 APN 14 68,008,526 (GRCm39) missense probably damaging 1.00
IGL01525:Dock5 APN 14 68,043,169 (GRCm39) splice site probably benign
IGL01759:Dock5 APN 14 68,118,708 (GRCm39) nonsense probably null
IGL01941:Dock5 APN 14 68,049,681 (GRCm39) missense probably damaging 1.00
IGL02025:Dock5 APN 14 68,000,736 (GRCm39) missense probably damaging 1.00
IGL02093:Dock5 APN 14 68,076,992 (GRCm39) splice site probably benign
IGL02179:Dock5 APN 14 68,043,945 (GRCm39) splice site probably benign
IGL02208:Dock5 APN 14 68,065,899 (GRCm39) missense probably benign 0.06
IGL02605:Dock5 APN 14 68,065,887 (GRCm39) missense probably benign 0.18
IGL02608:Dock5 APN 14 68,065,888 (GRCm39) missense probably benign 0.01
IGL02938:Dock5 APN 14 67,994,667 (GRCm39) splice site probably benign
IGL02971:Dock5 APN 14 67,994,558 (GRCm39) missense probably null 1.00
IGL02983:Dock5 APN 14 68,002,119 (GRCm39) missense probably damaging 1.00
IGL03151:Dock5 APN 14 68,103,516 (GRCm39) missense probably damaging 1.00
IGL03410:Dock5 APN 14 68,083,535 (GRCm39) missense probably benign 0.04
PIT4366001:Dock5 UTSW 14 68,062,123 (GRCm39) missense possibly damaging 0.83
R0026:Dock5 UTSW 14 68,083,530 (GRCm39) missense probably benign 0.00
R0058:Dock5 UTSW 14 68,018,485 (GRCm39) missense probably benign 0.00
R0058:Dock5 UTSW 14 68,018,485 (GRCm39) missense probably benign 0.00
R0112:Dock5 UTSW 14 68,057,090 (GRCm39) missense probably benign
R0127:Dock5 UTSW 14 68,083,491 (GRCm39) missense probably benign 0.13
R0144:Dock5 UTSW 14 68,023,735 (GRCm39) missense probably benign 0.18
R0312:Dock5 UTSW 14 68,033,440 (GRCm39) missense possibly damaging 0.82
R0360:Dock5 UTSW 14 68,060,129 (GRCm39) splice site probably benign
R0364:Dock5 UTSW 14 68,060,129 (GRCm39) splice site probably benign
R0496:Dock5 UTSW 14 68,054,967 (GRCm39) missense probably damaging 1.00
R0506:Dock5 UTSW 14 68,022,241 (GRCm39) splice site probably benign
R0586:Dock5 UTSW 14 68,046,481 (GRCm39) missense probably damaging 1.00
R0597:Dock5 UTSW 14 68,022,383 (GRCm39) splice site probably null
R0625:Dock5 UTSW 14 68,078,612 (GRCm39) missense probably benign
R1109:Dock5 UTSW 14 68,043,927 (GRCm39) missense possibly damaging 0.80
R1221:Dock5 UTSW 14 67,996,610 (GRCm39) missense probably benign 0.00
R1278:Dock5 UTSW 14 68,077,015 (GRCm39) missense possibly damaging 0.80
R1927:Dock5 UTSW 14 68,083,511 (GRCm39) missense possibly damaging 0.60
R1944:Dock5 UTSW 14 67,994,584 (GRCm39) nonsense probably null
R1946:Dock5 UTSW 14 68,023,765 (GRCm39) missense probably damaging 1.00
R2046:Dock5 UTSW 14 68,049,591 (GRCm39) missense probably benign
R2101:Dock5 UTSW 14 68,031,459 (GRCm39) missense probably benign 0.02
R2252:Dock5 UTSW 14 68,022,261 (GRCm39) missense probably damaging 0.98
R2882:Dock5 UTSW 14 68,077,069 (GRCm39) missense probably damaging 0.99
R3110:Dock5 UTSW 14 68,095,371 (GRCm39) missense possibly damaging 0.72
R3112:Dock5 UTSW 14 68,095,371 (GRCm39) missense possibly damaging 0.72
R4236:Dock5 UTSW 14 67,993,941 (GRCm39) missense probably benign 0.02
R4242:Dock5 UTSW 14 68,065,939 (GRCm39) missense probably benign 0.19
R4244:Dock5 UTSW 14 68,012,031 (GRCm39) missense probably benign 0.41
R4646:Dock5 UTSW 14 68,080,228 (GRCm39) missense probably benign 0.01
R4793:Dock5 UTSW 14 68,037,803 (GRCm39) missense probably benign 0.26
R4841:Dock5 UTSW 14 68,055,012 (GRCm39) missense probably damaging 0.98
R4842:Dock5 UTSW 14 68,055,012 (GRCm39) missense probably damaging 0.98
R5159:Dock5 UTSW 14 68,029,738 (GRCm39) missense probably benign 0.04
R5164:Dock5 UTSW 14 68,055,110 (GRCm39) nonsense probably null
R5206:Dock5 UTSW 14 68,000,633 (GRCm39) missense probably benign 0.35
R5207:Dock5 UTSW 14 68,013,733 (GRCm39) missense probably benign 0.06
R5322:Dock5 UTSW 14 68,007,715 (GRCm39) missense probably benign 0.41
R5374:Dock5 UTSW 14 68,043,205 (GRCm39) missense possibly damaging 0.81
R5413:Dock5 UTSW 14 68,002,104 (GRCm39) missense probably damaging 1.00
R5476:Dock5 UTSW 14 68,051,456 (GRCm39) missense possibly damaging 0.92
R5504:Dock5 UTSW 14 68,040,535 (GRCm39) missense probably benign 0.01
R5677:Dock5 UTSW 14 68,015,052 (GRCm39) missense probably benign 0.00
R5773:Dock5 UTSW 14 68,033,507 (GRCm39) missense possibly damaging 0.95
R5845:Dock5 UTSW 14 68,078,550 (GRCm39) missense possibly damaging 0.82
R5957:Dock5 UTSW 14 68,095,443 (GRCm39) missense probably benign
R6154:Dock5 UTSW 14 68,097,361 (GRCm39) missense probably benign 0.03
R6268:Dock5 UTSW 14 68,027,724 (GRCm39) nonsense probably null
R6393:Dock5 UTSW 14 68,060,051 (GRCm39) missense probably benign 0.32
R6512:Dock5 UTSW 14 68,062,097 (GRCm39) missense possibly damaging 0.93
R6759:Dock5 UTSW 14 68,033,445 (GRCm39) missense probably benign 0.00
R7012:Dock5 UTSW 14 68,060,035 (GRCm39) missense probably damaging 1.00
R7061:Dock5 UTSW 14 68,007,703 (GRCm39) missense probably damaging 0.96
R7196:Dock5 UTSW 14 67,993,919 (GRCm39) missense probably damaging 1.00
R7200:Dock5 UTSW 14 68,009,151 (GRCm39) nonsense probably null
R7311:Dock5 UTSW 14 68,065,951 (GRCm39) missense probably benign 0.25
R7359:Dock5 UTSW 14 68,003,337 (GRCm39) missense probably benign 0.10
R7422:Dock5 UTSW 14 68,046,479 (GRCm39) missense probably benign 0.01
R7588:Dock5 UTSW 14 68,000,607 (GRCm39) critical splice donor site probably null
R7637:Dock5 UTSW 14 68,023,789 (GRCm39) missense possibly damaging 0.95
R7763:Dock5 UTSW 14 68,058,776 (GRCm39) missense probably damaging 0.97
R8044:Dock5 UTSW 14 68,062,141 (GRCm39) missense probably damaging 1.00
R8076:Dock5 UTSW 14 68,040,426 (GRCm39) splice site probably null
R8168:Dock5 UTSW 14 68,007,646 (GRCm39) splice site probably null
R8353:Dock5 UTSW 14 68,054,957 (GRCm39) splice site probably null
R8480:Dock5 UTSW 14 68,073,859 (GRCm39) missense probably benign 0.32
R8535:Dock5 UTSW 14 68,031,425 (GRCm39) missense probably benign 0.19
R8708:Dock5 UTSW 14 68,004,820 (GRCm39) missense probably benign 0.02
R8732:Dock5 UTSW 14 68,083,449 (GRCm39) missense possibly damaging 0.85
R8888:Dock5 UTSW 14 68,055,112 (GRCm39) missense possibly damaging 0.95
R8895:Dock5 UTSW 14 68,055,112 (GRCm39) missense possibly damaging 0.95
R8936:Dock5 UTSW 14 68,083,439 (GRCm39) nonsense probably null
R8962:Dock5 UTSW 14 67,994,640 (GRCm39) missense probably benign
R8972:Dock5 UTSW 14 68,013,749 (GRCm39) missense probably damaging 1.00
R9244:Dock5 UTSW 14 67,996,563 (GRCm39) missense probably damaging 0.99
R9345:Dock5 UTSW 14 68,060,071 (GRCm39) missense possibly damaging 0.74
R9679:Dock5 UTSW 14 68,018,450 (GRCm39) missense probably damaging 1.00
X0023:Dock5 UTSW 14 68,008,537 (GRCm39) missense probably benign 0.15
Z1177:Dock5 UTSW 14 68,051,382 (GRCm39) missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- CAGGAGGATCATGACTTTGAGG -3'
(R):5'- CGGAAGCAGTGTTTCTAGTTCC -3'

Sequencing Primer
(F):5'- AGGATCATGACTTTGAGGATGAC -3'
(R):5'- CCAAGTGTCCTTATAGATAGAGCTCG -3'
Posted On 2019-11-12