Mutagenetix > Incidental Mutations

Incidental Mutation 'R0032:Olfr118'

59451

Institutional Source

Beutler Lab

Gene Symbol

Olfr118

Ensembl Gene

ENSMUSG00000080990

Gene Name

olfactory receptor 118

Synonyms

MOR263-13, GA_x6K02T2PSCP-2131124-2132089

MMRRC Submission

038326-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.071) question?

Stock #

R0032 (G1) of strain 731

Quality Score

224

Status

Validated

Chromosome

Chromosomal Location

37666988-37673476 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 37672487 bp

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Arginine at position 155 (W155R)

Ref Sequence

ENSEMBL: ENSMUSP00000151212 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000122036] [ENSMUST00000215811] [ENSMUST00000216551]

Predicted Effect

probably damaging
Transcript: ENSMUST00000122036
AA Change: W155R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000113988
Gene: ENSMUSG00000080990
AA Change: W155R

Domain	Start	End	E-Value	Type
Pfam:7TM_GPCR_Srv	32	173	2e-6	PFAM
Pfam:7tm_4	37	314	2.1e-57	PFAM
Pfam:7TM_GPCR_Srsx	41	311	5.8e-6	PFAM
Pfam:7tm_1	47	296	1.4e-24	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000215811
AA Change: W155R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000216551
AA Change: W155R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Meta Mutation Damage Score

0.9171

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.4%
20x: 94.8%

Validation Efficiency

100% (89/89)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acss3	T	A	10: 107,123,295	T97S	probably benign	Het
Adcy1	T	C	11: 7,144,729	S552P	possibly damaging	Het
Arrb1	T	C	7: 99,582,265	F9L	probably damaging	Het
Auts2	G	C	5: 131,440,093	D571E	probably damaging	Het
C2cd3	T	A	7: 100,444,445		probably benign	Het
Ccbe1	T	G	18: 66,291,652	T35P	possibly damaging	Het
Cct6b	G	T	11: 82,753,643	T202K	possibly damaging	Het
Cd86	A	T	16: 36,620,873	S77R	probably damaging	Het
Cdk5rap3	A	T	11: 96,908,753	L412Q	possibly damaging	Het
Cdsn	G	A	17: 35,555,555	G327D	probably damaging	Het
Cfap54	C	T	10: 92,932,697	R188H	probably benign	Het
Clca3a2	T	A	3: 144,816,733	I176F	probably benign	Het
Cop1	T	C	1: 159,325,036		probably null	Het
Cpne8	T	A	15: 90,569,568		probably benign	Het
Ctsg	T	A	14: 56,101,739	I21F	probably damaging	Het
Cyp2j9	T	G	4: 96,568,806	N476T	possibly damaging	Het
Dcaf4	G	A	12: 83,535,988		probably benign	Het
Dennd4c	T	C	4: 86,828,150		probably null	Het
Des	A	G	1: 75,362,166	E195G	possibly damaging	Het
Dicer1	A	T	12: 104,704,798	L995*	probably null	Het
Dnah10	A	G	5: 124,800,891	K2623R	possibly damaging	Het
Dnajc21	G	T	15: 10,461,877	T146K	probably benign	Het
Dnmbp	A	C	19: 43,902,719	L203R	probably damaging	Het
Eif4g1	C	T	16: 20,685,898	S829F	probably damaging	Het
Enkur	T	C	2: 21,189,304	I153V	probably benign	Het
Epb41l3	G	T	17: 69,210,384		probably null	Het
Erf	T	C	7: 25,245,075	Y277C	possibly damaging	Het
Fstl5	T	A	3: 76,648,435		probably benign	Het
Fuk	G	A	8: 110,892,103	T341M	possibly damaging	Het
Galnt16	T	C	12: 80,592,469	V419A	probably damaging	Het
Gm10226	A	G	17: 21,692,056	D66G	possibly damaging	Het
Gm15821	T	A	17: 34,212,225		probably benign	Het
Grm3	A	G	5: 9,511,452		probably null	Het
Il11ra1	A	G	4: 41,768,187	E366G	probably damaging	Het
Impdh2	A	G	9: 108,561,661	D71G	probably damaging	Het
Ipo11	A	C	13: 106,834,463		probably benign	Het
Ipo8	A	G	6: 148,810,711	C261R	probably damaging	Het
Iqsec3	T	C	6: 121,473,130	D145G	possibly damaging	Het
Itga11	T	C	9: 62,774,095	F998L	probably benign	Het
Junb	T	C	8: 84,977,786	H215R	probably benign	Het
Kcnh4	C	T	11: 100,746,932	G633E	probably benign	Het
Kcnn3	CGCAGCAGCAGCAGCAGCAGCAG	CGCAGCAGCAGCAGCAGCAG	3: 89,520,665		probably benign	Het
Krt73	T	C	15: 101,794,052	S459G	probably benign	Het
Krt74	T	A	15: 101,761,452		noncoding transcript	Het
Meis3	C	A	7: 16,182,285		probably benign	Het
Mlh3	A	G	12: 85,245,749		probably benign	Het
Mroh2a	GT	GTT	1: 88,256,166		probably null	Het
Naip6	C	T	13: 100,303,237	E341K	probably benign	Het
Nbeal2	G	T	9: 110,637,868		probably benign	Het
Nfx1	T	A	4: 41,015,321	V842E	probably benign	Het
Olfr800	T	A	10: 129,660,400	V198D	probably benign	Het
Olfr891	A	G	9: 38,180,608	C72R	probably damaging	Het
Oma1	T	A	4: 103,366,012	S465T	possibly damaging	Het
Opa1	A	T	16: 29,615,069	H574L	probably damaging	Het
Otog	T	A	7: 46,288,213	L1782*	probably null	Het
Otog	G	A	7: 46,304,231	V2638M	probably damaging	Het
Pcsk5	T	C	19: 17,564,815	N804S	possibly damaging	Het
Pde4a	C	A	9: 21,201,432		probably benign	Het
Pilra	T	A	5: 137,831,265	D179V	probably damaging	Het
Piwil1	G	A	5: 128,743,280	S247N	probably benign	Het
Ppp2r1a	G	A	17: 20,945,584		probably benign	Het
Prss58	T	G	6: 40,895,699	T158P	probably benign	Het
Setmar	T	A	6: 108,076,416	C290*	probably null	Het
Slc35e3	T	C	10: 117,744,932	M156V	probably benign	Het
Slc4a5	T	A	6: 83,273,157	I509N	probably damaging	Het
Slit2	G	A	5: 48,256,856	R938Q	probably damaging	Het
Snrpn	A	G	7: 59,985,082	Y168H	probably damaging	Het
Sycn	C	T	7: 28,541,292	A128V	possibly damaging	Het
Synm	C	A	7: 67,733,927	R1329M	possibly damaging	Het
Syt8	T	C	7: 142,439,189	V152A	probably benign	Het
Tcp10a	T	C	17: 7,336,907	M247T	probably benign	Het
Tjp2	A	G	19: 24,108,695	L821S	probably damaging	Het
Tppp2	G	T	14: 51,919,409	R81L	possibly damaging	Het
Trim34b	A	G	7: 104,336,577	D473G	possibly damaging	Het
Trpc3	A	G	3: 36,644,256	I618T	probably damaging	Het
Trpm5	A	T	7: 143,085,241	D264E	probably damaging	Het
Tuba8	A	T	6: 121,225,904	D392V	probably benign	Het
Vmn1r50	C	A	6: 90,107,800	P176T	probably damaging	Het
Vmn1r76	T	C	7: 11,931,267	I7V	probably benign	Het
Vmn2r26	T	A	6: 124,039,899	W441R	possibly damaging	Het
Vmn2r57	T	C	7: 41,399,733		probably null	Het
Zc3h4	T	A	7: 16,434,640	D891E	unknown	Het
Zfp120	A	T	2: 150,117,592	V270E	possibly damaging	Het
Znhit1	G	C	5: 136,985,047	R8G	possibly damaging	Het

Other mutations in Olfr118

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01300:Olfr118	APN	17	37672887	missense	probably damaging	1.00
IGL02456:Olfr118	APN	17	37672449	missense	possibly damaging	0.90
IGL02750:Olfr118	APN	17	37672609	nonsense	probably null
IGL03083:Olfr118	APN	17	37672660	nonsense	probably null
IGL03339:Olfr118	APN	17	37672557	missense	possibly damaging	0.87
R1457:Olfr118	UTSW	17	37672925	nonsense	probably null
R1542:Olfr118	UTSW	17	37672251	missense	probably damaging	1.00
R1771:Olfr118	UTSW	17	37672663	missense	probably damaging	1.00
R1893:Olfr118	UTSW	17	37672856	nonsense	probably null
R2395:Olfr118	UTSW	17	37672696	nonsense	probably null
R3619:Olfr118	UTSW	17	37672640	missense	probably benign	0.05
R3917:Olfr118	UTSW	17	37672793	missense	probably damaging	1.00
R3937:Olfr118	UTSW	17	37672967	missense	probably benign	0.01
R5600:Olfr118	UTSW	17	37672285	missense	possibly damaging	0.91
R6415:Olfr118	UTSW	17	37672557	missense	possibly damaging	0.87
R6462:Olfr118	UTSW	17	37672220	missense	probably damaging	1.00
R7355:Olfr118	UTSW	17	37672410	missense	probably benign	0.02
R7861:Olfr118	UTSW	17	37672517	missense	possibly damaging	0.91
R7913:Olfr118	UTSW	17	37672108	missense	probably benign
R7952:Olfr118	UTSW	17	37672817	missense	probably damaging	1.00
R7969:Olfr118	UTSW	17	37672656	missense	probably damaging	1.00
R8879:Olfr118	UTSW	17	37672411	nonsense	probably null
R8923:Olfr118	UTSW	17	37672811	missense	probably benign	0.00
RF003:Olfr118	UTSW	17	37672858	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGTTCCTGAAGAATGCTTCCTCCTG -3'
(R):5'- AGAGAACTACGGCCACAAAGATTGC -3'

Sequencing Primer
(F):5'- CTGTCATACCGAAGATGTTGC -3'
(R):5'- CAAAGATTGCAGCCTCATTTTGG -3'

Posted On

2013-07-11