Incidental Mutation 'R7710:Ctnnbl1'
ID 594516
Institutional Source Beutler Lab
Gene Symbol Ctnnbl1
Ensembl Gene ENSMUSG00000027649
Gene Name catenin, beta like 1
Synonyms P14L, FLJ21108, NYD-SP19, 5730471K09Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.964) question?
Stock # R7710 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 157737401-157891614 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 157774571 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 64 (D64G)
Ref Sequence ENSEMBL: ENSMUSP00000029178 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029178]
AlphaFold Q9CWL8
Predicted Effect probably benign
Transcript: ENSMUST00000029178
AA Change: D64G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000029178
Gene: ENSMUSG00000027649
AA Change: D64G

DomainStartEndE-ValueType
DUF1716 52 162 3.97e-61 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the pre-mRNA-processing factor 19-cell division cycle 5-like (PRP19-CDC5L) protein complex, which activates pre-mRNA splicing and is an integral part of the spliceosome. The encoded protein is also a nuclear localization sequence binding protein, and binds to activation-induced deaminase and is important for antibody diversification. This gene may also be associated with the development of obesity. Alternative splicing results in multiple transcript variants. A pseudogene of this gene has been defined on the X chromosome. [provided by RefSeq, Jul 2013]
PHENOTYPE:
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl1 G A 4: 86,232,573 E151K Het
Ap3b1 T C 13: 94,451,073 S452P probably damaging Het
Cacna2d4 A G 6: 119,274,239 I463V probably benign Het
Ccdc142 T C 6: 83,101,696 S5P probably benign Het
Cd300ld C T 11: 114,984,212 V199M probably damaging Het
Cep162 T C 9: 87,232,119 Y300C probably damaging Het
Ces2h C T 8: 105,000,865 Q5* probably null Het
Col9a3 C T 2: 180,609,365 L310F probably damaging Het
Copa A G 1: 172,109,844 D454G possibly damaging Het
Ctnnbip1 A C 4: 149,545,820 M29L probably benign Het
Dcxr T A 11: 120,727,082 T23S probably benign Het
Dennd1b T A 1: 139,062,932 H211Q probably damaging Het
Ercc8 G A 13: 108,183,863 A328T probably benign Het
Fam217a T C 13: 34,911,128 D216G possibly damaging Het
Fam26d A T 10: 34,044,049 M74K possibly damaging Het
Fat2 T A 11: 55,310,763 Y495F probably benign Het
Fbxw13 G A 9: 109,195,900 S15F probably damaging Het
Fras1 T A 5: 96,645,103 C964* probably null Het
Fshr T A 17: 88,985,255 H665L probably benign Het
Gm10447 A T 11: 53,456,610 C31S unknown Het
Gm13272 A T 4: 88,780,349 Q167L probably benign Het
Gtpbp2 T C 17: 46,167,787 I510T possibly damaging Het
Hps6 G A 19: 46,004,568 A315T probably benign Het
Igfbp6 A C 15: 102,147,850 T115P probably damaging Het
Ikzf4 A G 10: 128,632,741 V623A possibly damaging Het
Il11ra1 T C 4: 41,764,846 V100A probably benign Het
Ints1 T C 5: 139,771,085 T493A probably benign Het
Itgax C T 7: 128,135,856 T453I probably benign Het
Kras T C 6: 145,220,628 T183A probably benign Het
Lhcgr T C 17: 88,742,782 T439A probably damaging Het
Lrrn4 T C 2: 132,879,531 H122R probably benign Het
Muc2 A T 7: 141,700,883 R210S possibly damaging Het
Myh7 C G 14: 54,988,801 D461H probably damaging Het
Myo18b T C 5: 112,875,025 D167G unknown Het
Nedd8 G A 14: 55,671,989 probably benign Het
Olfr1442 A C 19: 12,674,976 Y257S probably damaging Het
Pars2 T A 4: 106,654,079 Y353N probably damaging Het
Pbxip1 T A 3: 89,448,101 D642E probably damaging Het
Pcdhb10 A T 18: 37,413,601 R577* probably null Het
Pcna-ps2 T A 19: 9,284,125 Y249* probably null Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Pla2g6 A T 15: 79,287,158 V744E probably damaging Het
Ppfibp1 A G 6: 146,996,405 I207V probably benign Het
Prr11 T C 11: 87,103,607 D71G probably benign Het
Rnf150 A C 8: 82,864,152 Y48S probably damaging Het
Rsf1 G A 7: 97,681,834 G1237D Het
Rusc2 C T 4: 43,416,119 T475I probably benign Het
Scgb1b20 T A 7: 33,373,442 I25N probably damaging Het
Sdr39u1 T C 14: 55,899,659 N65S probably benign Het
Sh3gl3 T C 7: 82,284,086 V219A possibly damaging Het
Shcbp1 A G 8: 4,764,965 F171S probably benign Het
Shq1 A G 6: 100,671,045 F6S probably damaging Het
Slc12a4 C T 8: 105,945,571 R868H possibly damaging Het
Smg6 T C 11: 74,930,619 V572A probably benign Het
Syn3 A G 10: 86,407,670 V135A probably damaging Het
Tarsl2 A T 7: 65,664,969 D425V probably benign Het
Tmem253 A T 14: 52,017,151 Q21L possibly damaging Het
Trpm3 G T 19: 22,918,790 R997L probably damaging Het
Ubr5 G A 15: 37,979,832 A2434V probably null Het
Ugt1a9 A G 1: 88,071,109 T94A probably benign Het
Vmn1r62 A G 7: 5,675,183 probably benign Het
Vmn2r61 T C 7: 42,267,048 C362R probably damaging Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,815,240 probably benign Het
Zfp94 T C 7: 24,303,682 K112E probably benign Het
Zfp954 A T 7: 7,117,890 V47E probably damaging Het
Other mutations in Ctnnbl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00754:Ctnnbl1 APN 2 157819541 missense possibly damaging 0.80
IGL01374:Ctnnbl1 APN 2 157836693 critical splice donor site probably null
IGL01504:Ctnnbl1 APN 2 157818116 splice site probably benign
IGL01622:Ctnnbl1 APN 2 157819548 missense probably damaging 1.00
IGL01623:Ctnnbl1 APN 2 157819548 missense probably damaging 1.00
IGL02146:Ctnnbl1 APN 2 157819494 missense probably damaging 1.00
IGL02550:Ctnnbl1 APN 2 157884135 missense probably benign 0.00
IGL03104:Ctnnbl1 APN 2 157890965 missense probably damaging 0.99
IGL03164:Ctnnbl1 APN 2 157817761 missense probably benign
R0482:Ctnnbl1 UTSW 2 157871190 critical splice donor site probably null
R0826:Ctnnbl1 UTSW 2 157799417 splice site probably benign
R0827:Ctnnbl1 UTSW 2 157799417 splice site probably benign
R0862:Ctnnbl1 UTSW 2 157799417 splice site probably benign
R0863:Ctnnbl1 UTSW 2 157799417 splice site probably benign
R0864:Ctnnbl1 UTSW 2 157799417 splice site probably benign
R1466:Ctnnbl1 UTSW 2 157799417 splice site probably benign
R1533:Ctnnbl1 UTSW 2 157836643 missense probably benign
R2971:Ctnnbl1 UTSW 2 157871186 missense probably benign 0.06
R3522:Ctnnbl1 UTSW 2 157871193 splice site probably null
R4296:Ctnnbl1 UTSW 2 157819570 splice site probably null
R4982:Ctnnbl1 UTSW 2 157836553 missense probably benign 0.01
R5396:Ctnnbl1 UTSW 2 157817832 splice site probably null
R5857:Ctnnbl1 UTSW 2 157789098 missense probably damaging 1.00
R7769:Ctnnbl1 UTSW 2 157737470 start gained probably benign
R8134:Ctnnbl1 UTSW 2 157809471 missense probably benign 0.19
R8324:Ctnnbl1 UTSW 2 157779815 missense probably damaging 0.97
R8384:Ctnnbl1 UTSW 2 157818060 missense probably benign 0.01
R8430:Ctnnbl1 UTSW 2 157836683 missense probably damaging 0.99
R9116:Ctnnbl1 UTSW 2 157806703 missense probably damaging 1.00
R9244:Ctnnbl1 UTSW 2 157836663 missense possibly damaging 0.63
R9350:Ctnnbl1 UTSW 2 157809525 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- AGAATGCTTGATGCCTGTGC -3'
(R):5'- TGCAAATTCTTTCCAGACTCAACTC -3'

Sequencing Primer
(F):5'- AGAATGCTTGATGCCTGTGCTTTAAC -3'
(R):5'- ACCCATCCTCGGCCTCAG -3'
Posted On 2019-11-12