Mutagenetix > Incidental Mutations

Incidental Mutation 'R7710:Ctnnbl1'

594516

Institutional Source

Beutler Lab

Gene Symbol

Ctnnbl1

Ensembl Gene

ENSMUSG00000027649

Gene Name

catenin, beta like 1

Synonyms

P14L, FLJ21108, NYD-SP19, 5730471K09Rik

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.957) question?

Stock #

R7710 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

157737401-157891614 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 157774571 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 64 (D64G)

Ref Sequence

ENSEMBL: ENSMUSP00000029178 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029178]

Predicted Effect

probably benign
Transcript: ENSMUST00000029178
AA Change: D64G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000029178
Gene: ENSMUSG00000027649
AA Change: D64G

Domain	Start	End	E-Value	Type
DUF1716	52	162	3.97e-61	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the pre-mRNA-processing factor 19-cell division cycle 5-like (PRP19-CDC5L) protein complex, which activates pre-mRNA splicing and is an integral part of the spliceosome. The encoded protein is also a nuclear localization sequence binding protein, and binds to activation-induced deaminase and is important for antibody diversification. This gene may also be associated with the development of obesity. Alternative splicing results in multiple transcript variants. A pseudogene of this gene has been defined on the X chromosome. [provided by RefSeq, Jul 2013]
PHENOTYPE:

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamtsl1	G	A	4: 86,232,573	E151K		Het
Ap3b1	T	C	13: 94,451,073	S452P	probably damaging	Het
Cacna2d4	A	G	6: 119,274,239	I463V	probably benign	Het
Ccdc142	T	C	6: 83,101,696	S5P	probably benign	Het
Cd300ld	C	T	11: 114,984,212	V199M	probably damaging	Het
Cep162	T	C	9: 87,232,119	Y300C	probably damaging	Het
Ces2h	C	T	8: 105,000,865	Q5*	probably null	Het
Col9a3	C	T	2: 180,609,365	L310F	probably damaging	Het
Copa	A	G	1: 172,109,844	D454G	possibly damaging	Het
Ctnnbip1	A	C	4: 149,545,820	M29L	probably benign	Het
Dcxr	T	A	11: 120,727,082	T23S	probably benign	Het
Dennd1b	T	A	1: 139,062,932	H211Q	probably damaging	Het
Ercc8	G	A	13: 108,183,863	A328T	probably benign	Het
Fam217a	T	C	13: 34,911,128	D216G	possibly damaging	Het
Fam26d	A	T	10: 34,044,049	M74K	possibly damaging	Het
Fat2	T	A	11: 55,310,763	Y495F	probably benign	Het
Fbxw13	G	A	9: 109,195,900	S15F	probably damaging	Het
Fras1	T	A	5: 96,645,103	C964*	probably null	Het
Fshr	T	A	17: 88,985,255	H665L	probably benign	Het
Gm10447	A	T	11: 53,456,610	C31S	unknown	Het
Gm13272	A	T	4: 88,780,349	Q167L	probably benign	Het
Gtpbp2	T	C	17: 46,167,787	I510T	possibly damaging	Het
Hps6	G	A	19: 46,004,568	A315T	probably benign	Het
Igfbp6	A	C	15: 102,147,850	T115P	probably damaging	Het
Ikzf4	A	G	10: 128,632,741	V623A	possibly damaging	Het
Il11ra1	T	C	4: 41,764,846	V100A	probably benign	Het
Ints1	T	C	5: 139,771,085	T493A	probably benign	Het
Itgax	C	T	7: 128,135,856	T453I	probably benign	Het
Kras	T	C	6: 145,220,628	T183A	probably benign	Het
Lhcgr	T	C	17: 88,742,782	T439A	probably damaging	Het
Lrrn4	T	C	2: 132,879,531	H122R	probably benign	Het
Muc2	A	T	7: 141,700,883	R210S	possibly damaging	Het
Myh7	C	G	14: 54,988,801	D461H	probably damaging	Het
Myo18b	T	C	5: 112,875,025	D167G	unknown	Het
Nedd8	G	A	14: 55,671,989		probably benign	Het
Olfr1442	A	C	19: 12,674,976	Y257S	probably damaging	Het
Pars2	T	A	4: 106,654,079	Y353N	probably damaging	Het
Pbxip1	T	A	3: 89,448,101	D642E	probably damaging	Het
Pcdhb10	A	T	18: 37,413,601	R577*	probably null	Het
Pcna-ps2	T	A	19: 9,284,125	Y249*	probably null	Het
Peg10	GC	GCTCC	6: 4,756,452		probably benign	Het
Pla2g6	A	T	15: 79,287,158	V744E	probably damaging	Het
Ppfibp1	A	G	6: 146,996,405	I207V	probably benign	Het
Prr11	T	C	11: 87,103,607	D71G	probably benign	Het
Rnf150	A	C	8: 82,864,152	Y48S	probably damaging	Het
Rsf1	G	A	7: 97,681,834	G1237D		Het
Rusc2	C	T	4: 43,416,119	T475I	probably benign	Het
Scgb1b20	T	A	7: 33,373,442	I25N	probably damaging	Het
Sdr39u1	T	C	14: 55,899,659	N65S	probably benign	Het
Sh3gl3	T	C	7: 82,284,086	V219A	possibly damaging	Het
Shcbp1	A	G	8: 4,764,965	F171S	probably benign	Het
Shq1	A	G	6: 100,671,045	F6S	probably damaging	Het
Slc12a4	C	T	8: 105,945,571	R868H	possibly damaging	Het
Smg6	T	C	11: 74,930,619	V572A	probably benign	Het
Syn3	A	G	10: 86,407,670	V135A	probably damaging	Het
Tarsl2	A	T	7: 65,664,969	D425V	probably benign	Het
Tmem253	A	T	14: 52,017,151	Q21L	possibly damaging	Het
Trpm3	G	T	19: 22,918,790	R997L	probably damaging	Het
Ubr5	G	A	15: 37,979,832	A2434V	probably null	Het
Ugt1a9	A	G	1: 88,071,109	T94A	probably benign	Het
Vmn1r62	A	G	7: 5,675,183		probably benign	Het
Vmn2r61	T	C	7: 42,267,048	C362R	probably damaging	Het
Zfp354c	TCACACTCGGCACA	TCACA	11: 50,815,240		probably benign	Het
Zfp94	T	C	7: 24,303,682	K112E	probably benign	Het
Zfp954	A	T	7: 7,117,890	V47E	probably damaging	Het

Other mutations in Ctnnbl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00754:Ctnnbl1	APN	2	157819541	missense	possibly damaging	0.80
IGL01374:Ctnnbl1	APN	2	157836693	critical splice donor site	probably null
IGL01504:Ctnnbl1	APN	2	157818116	splice site	probably benign
IGL01622:Ctnnbl1	APN	2	157819548	missense	probably damaging	1.00
IGL01623:Ctnnbl1	APN	2	157819548	missense	probably damaging	1.00
IGL02146:Ctnnbl1	APN	2	157819494	missense	probably damaging	1.00
IGL02550:Ctnnbl1	APN	2	157884135	missense	probably benign	0.00
IGL03104:Ctnnbl1	APN	2	157890965	missense	probably damaging	0.99
IGL03164:Ctnnbl1	APN	2	157817761	missense	probably benign
R0482:Ctnnbl1	UTSW	2	157871190	critical splice donor site	probably null
R0826:Ctnnbl1	UTSW	2	157799417	splice site	probably benign
R0827:Ctnnbl1	UTSW	2	157799417	splice site	probably benign
R0862:Ctnnbl1	UTSW	2	157799417	splice site	probably benign
R0863:Ctnnbl1	UTSW	2	157799417	splice site	probably benign
R0864:Ctnnbl1	UTSW	2	157799417	splice site	probably benign
R1466:Ctnnbl1	UTSW	2	157799417	splice site	probably benign
R1533:Ctnnbl1	UTSW	2	157836643	missense	probably benign
R2971:Ctnnbl1	UTSW	2	157871186	missense	probably benign	0.06
R3522:Ctnnbl1	UTSW	2	157871193	splice site	probably null
R4296:Ctnnbl1	UTSW	2	157819570	splice site	probably null
R4982:Ctnnbl1	UTSW	2	157836553	missense	probably benign	0.01
R5396:Ctnnbl1	UTSW	2	157817832	splice site	probably null
R5857:Ctnnbl1	UTSW	2	157789098	missense	probably damaging	1.00
R7769:Ctnnbl1	UTSW	2	157737470	start gained	probably benign
R8134:Ctnnbl1	UTSW	2	157809471	missense	probably benign	0.19
R8324:Ctnnbl1	UTSW	2	157779815	missense	probably damaging	0.97
R8384:Ctnnbl1	UTSW	2	157818060	missense	probably benign	0.01
R8430:Ctnnbl1	UTSW	2	157836683	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- AGAATGCTTGATGCCTGTGC -3'
(R):5'- TGCAAATTCTTTCCAGACTCAACTC -3'

Sequencing Primer
(F):5'- AGAATGCTTGATGCCTGTGCTTTAAC -3'
(R):5'- ACCCATCCTCGGCCTCAG -3'

Posted On

2019-11-12