Incidental Mutation 'R7710:Pbxip1'
ID594518
Institutional Source Beutler Lab
Gene Symbol Pbxip1
Ensembl Gene ENSMUSG00000042613
Gene Namepre B cell leukemia transcription factor interacting protein 1
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R7710 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location89436706-89450952 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 89448101 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 642 (D642E)
Ref Sequence ENSEMBL: ENSMUSP00000040429 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038942] [ENSMUST00000130858] [ENSMUST00000145753] [ENSMUST00000146630]
Predicted Effect probably damaging
Transcript: ENSMUST00000038942
AA Change: D642E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000040429
Gene: ENSMUSG00000042613
AA Change: D642E

DomainStartEndE-ValueType
low complexity region 142 152 N/A INTRINSIC
low complexity region 162 177 N/A INTRINSIC
transmembrane domain 187 209 N/A INTRINSIC
coiled coil region 270 350 N/A INTRINSIC
coiled coil region 379 405 N/A INTRINSIC
low complexity region 672 691 N/A INTRINSIC
low complexity region 692 703 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130858
SMART Domains Protein: ENSMUSP00000118496
Gene: ENSMUSG00000042613

DomainStartEndE-ValueType
low complexity region 149 159 N/A INTRINSIC
low complexity region 169 184 N/A INTRINSIC
transmembrane domain 194 216 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145753
SMART Domains Protein: ENSMUSP00000121658
Gene: ENSMUSG00000042613

DomainStartEndE-ValueType
low complexity region 142 152 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146630
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene interacts with the PBX1 homeodomain protein, inhibiting its transcriptional activation potential by preventing its binding to DNA. The encoded protein, which is primarily cytosolic but can shuttle to the nucleus, also can interact with estrogen receptors alpha and beta and promote the proliferation of breast cancer, brain tumors, and lung cancer. Several transcript variants encoding different isoforms have been found for this gene. More variants exist, but their full-length natures have yet to be determined. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl1 G A 4: 86,232,573 E151K Het
Ap3b1 T C 13: 94,451,073 S452P probably damaging Het
Cacna2d4 A G 6: 119,274,239 I463V probably benign Het
Ccdc142 T C 6: 83,101,696 S5P probably benign Het
Cd300ld C T 11: 114,984,212 V199M probably damaging Het
Cep162 T C 9: 87,232,119 Y300C probably damaging Het
Ces2h C T 8: 105,000,865 Q5* probably null Het
Col9a3 C T 2: 180,609,365 L310F probably damaging Het
Copa A G 1: 172,109,844 D454G possibly damaging Het
Ctnnbip1 A C 4: 149,545,820 M29L probably benign Het
Ctnnbl1 A G 2: 157,774,571 D64G probably benign Het
Dcxr T A 11: 120,727,082 T23S probably benign Het
Dennd1b T A 1: 139,062,932 H211Q probably damaging Het
Ercc8 G A 13: 108,183,863 A328T probably benign Het
Fam217a T C 13: 34,911,128 D216G possibly damaging Het
Fam26d A T 10: 34,044,049 M74K possibly damaging Het
Fat2 T A 11: 55,310,763 Y495F probably benign Het
Fbxw13 G A 9: 109,195,900 S15F probably damaging Het
Fras1 T A 5: 96,645,103 C964* probably null Het
Fshr T A 17: 88,985,255 H665L probably benign Het
Gm10447 A T 11: 53,456,610 C31S unknown Het
Gm13272 A T 4: 88,780,349 Q167L probably benign Het
Gtpbp2 T C 17: 46,167,787 I510T possibly damaging Het
Hps6 G A 19: 46,004,568 A315T probably benign Het
Igfbp6 A C 15: 102,147,850 T115P probably damaging Het
Ikzf4 A G 10: 128,632,741 V623A possibly damaging Het
Il11ra1 T C 4: 41,764,846 V100A probably benign Het
Ints1 T C 5: 139,771,085 T493A probably benign Het
Itgax C T 7: 128,135,856 T453I probably benign Het
Kras T C 6: 145,220,628 T183A probably benign Het
Lhcgr T C 17: 88,742,782 T439A probably damaging Het
Lrrn4 T C 2: 132,879,531 H122R probably benign Het
Muc2 A T 7: 141,700,883 R210S possibly damaging Het
Myh7 C G 14: 54,988,801 D461H probably damaging Het
Myo18b T C 5: 112,875,025 D167G unknown Het
Nedd8 G A 14: 55,671,989 probably benign Het
Olfr1442 A C 19: 12,674,976 Y257S probably damaging Het
Pars2 T A 4: 106,654,079 Y353N probably damaging Het
Pcdhb10 A T 18: 37,413,601 R577* probably null Het
Pcna-ps2 T A 19: 9,284,125 Y249* probably null Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Pla2g6 A T 15: 79,287,158 V744E probably damaging Het
Ppfibp1 A G 6: 146,996,405 I207V probably benign Het
Prr11 T C 11: 87,103,607 D71G probably benign Het
Rnf150 A C 8: 82,864,152 Y48S probably damaging Het
Rsf1 G A 7: 97,681,834 G1237D Het
Rusc2 C T 4: 43,416,119 T475I probably benign Het
Scgb1b20 T A 7: 33,373,442 I25N probably damaging Het
Sdr39u1 T C 14: 55,899,659 N65S probably benign Het
Sh3gl3 T C 7: 82,284,086 V219A possibly damaging Het
Shcbp1 A G 8: 4,764,965 F171S probably benign Het
Shq1 A G 6: 100,671,045 F6S probably damaging Het
Slc12a4 C T 8: 105,945,571 R868H possibly damaging Het
Smg6 T C 11: 74,930,619 V572A probably benign Het
Syn3 A G 10: 86,407,670 V135A probably damaging Het
Tarsl2 A T 7: 65,664,969 D425V probably benign Het
Tmem253 A T 14: 52,017,151 Q21L possibly damaging Het
Trpm3 G T 19: 22,918,790 R997L probably damaging Het
Ubr5 G A 15: 37,979,832 A2434V probably null Het
Ugt1a9 A G 1: 88,071,109 T94A probably benign Het
Vmn1r62 A G 7: 5,675,183 probably benign Het
Vmn2r61 T C 7: 42,267,048 C362R probably damaging Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,815,240 probably benign Het
Zfp94 T C 7: 24,303,682 K112E probably benign Het
Zfp954 A T 7: 7,117,890 V47E probably damaging Het
Other mutations in Pbxip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01599:Pbxip1 APN 3 89443590 splice site probably benign
IGL02612:Pbxip1 APN 3 89443681 missense probably damaging 1.00
IGL02718:Pbxip1 APN 3 89448004 missense probably damaging 1.00
R0538:Pbxip1 UTSW 3 89447619 missense possibly damaging 0.79
R0549:Pbxip1 UTSW 3 89443592 splice site probably benign
R1460:Pbxip1 UTSW 3 89445614 missense probably damaging 1.00
R1931:Pbxip1 UTSW 3 89447677 splice site probably null
R1966:Pbxip1 UTSW 3 89445488 missense probably damaging 1.00
R2008:Pbxip1 UTSW 3 89448713 missense probably benign 0.20
R3435:Pbxip1 UTSW 3 89447236 missense probably damaging 0.99
R4504:Pbxip1 UTSW 3 89446383 missense possibly damaging 0.48
R4591:Pbxip1 UTSW 3 89446160 missense probably benign 0.33
R5491:Pbxip1 UTSW 3 89443159 missense probably benign 0.09
R6051:Pbxip1 UTSW 3 89443170 missense probably benign 0.08
R6620:Pbxip1 UTSW 3 89447826 missense probably benign 0.12
R7203:Pbxip1 UTSW 3 89447428 missense possibly damaging 0.68
R7259:Pbxip1 UTSW 3 89445633 missense probably benign
R7604:Pbxip1 UTSW 3 89445595 missense probably benign 0.01
R7687:Pbxip1 UTSW 3 89448199 missense probably damaging 1.00
R7980:Pbxip1 UTSW 3 89446341 missense probably benign 0.44
R8218:Pbxip1 UTSW 3 89445595 missense probably benign
R8754:Pbxip1 UTSW 3 89447928 missense probably damaging 1.00
R8923:Pbxip1 UTSW 3 89445614 missense possibly damaging 0.78
R8951:Pbxip1 UTSW 3 89445557 missense probably benign 0.05
X0012:Pbxip1 UTSW 3 89445523 missense possibly damaging 0.91
X0012:Pbxip1 UTSW 3 89446383 missense possibly damaging 0.48
Z1177:Pbxip1 UTSW 3 89447220 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- AGGCAGAAGCATTCTTGGGG -3'
(R):5'- AGACCTCTTCATTCAGGGCC -3'

Sequencing Primer
(F):5'- TGCTGAGGCGCAAGTAC -3'
(R):5'- TTCATTCAGGGCCCAACG -3'
Posted On2019-11-12