Incidental Mutation 'R7710:Il11ra1'
ID594519
Institutional Source Beutler Lab
Gene Symbol Il11ra1
Ensembl Gene ENSMUSG00000073889
Gene Nameinterleukin 11 receptor, alpha chain 1
SynonymsIl11ra, Il-11ra, NR1, Il-11ra-alpha
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.817) question?
Stock #R7710 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location41699989-41769474 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 41764846 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 100 (V100A)
Ref Sequence ENSEMBL: ENSMUSP00000095736 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074387] [ENSMUST00000098132] [ENSMUST00000108033] [ENSMUST00000108035] [ENSMUST00000108036] [ENSMUST00000108037] [ENSMUST00000108040] [ENSMUST00000108041] [ENSMUST00000108042] [ENSMUST00000151142]
Predicted Effect probably benign
Transcript: ENSMUST00000074387
SMART Domains Protein: ENSMUSP00000073990
Gene: ENSMUSG00000073888

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
SCY 31 97 5.12e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000098132
AA Change: V100A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000095736
Gene: ENSMUSG00000073889
AA Change: V100A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IG 33 108 5.75e-4 SMART
FN3 112 204 2.18e-2 SMART
FN3 218 304 4.93e-1 SMART
low complexity region 354 365 N/A INTRINSIC
transmembrane domain 369 391 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108033
SMART Domains Protein: ENSMUSP00000103668
Gene: ENSMUSG00000073888

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SCY 30 96 5.12e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108035
SMART Domains Protein: ENSMUSP00000103670
Gene: ENSMUSG00000073888

DomainStartEndE-ValueType
SCY 38 104 5.12e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108036
SMART Domains Protein: ENSMUSP00000103671
Gene: ENSMUSG00000073888

DomainStartEndE-ValueType
SCY 75 141 5.12e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108037
SMART Domains Protein: ENSMUSP00000103672
Gene: ENSMUSG00000073888

DomainStartEndE-ValueType
SCY 75 141 5.12e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108040
AA Change: V100A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000103675
Gene: ENSMUSG00000073889
AA Change: V100A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IG 33 108 5.75e-4 SMART
FN3 112 204 2.18e-2 SMART
FN3 218 304 4.93e-1 SMART
low complexity region 354 365 N/A INTRINSIC
transmembrane domain 369 391 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108041
AA Change: V100A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000103676
Gene: ENSMUSG00000073889
AA Change: V100A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IG 33 108 5.75e-4 SMART
FN3 112 204 2.18e-2 SMART
FN3 218 304 4.93e-1 SMART
low complexity region 354 365 N/A INTRINSIC
transmembrane domain 369 391 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108042
AA Change: V100A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000103677
Gene: ENSMUSG00000073889
AA Change: V100A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IG 33 108 5.75e-4 SMART
FN3 112 204 2.18e-2 SMART
FN3 218 304 4.93e-1 SMART
low complexity region 354 365 N/A INTRINSIC
transmembrane domain 369 391 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151142
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Female homozygotes for targeted null mutations are infertile due to defective decidua formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl1 G A 4: 86,232,573 E151K Het
Ap3b1 T C 13: 94,451,073 S452P probably damaging Het
Cacna2d4 A G 6: 119,274,239 I463V probably benign Het
Ccdc142 T C 6: 83,101,696 S5P probably benign Het
Cd300ld C T 11: 114,984,212 V199M probably damaging Het
Cep162 T C 9: 87,232,119 Y300C probably damaging Het
Ces2h C T 8: 105,000,865 Q5* probably null Het
Col9a3 C T 2: 180,609,365 L310F probably damaging Het
Copa A G 1: 172,109,844 D454G possibly damaging Het
Ctnnbip1 A C 4: 149,545,820 M29L probably benign Het
Ctnnbl1 A G 2: 157,774,571 D64G probably benign Het
Dcxr T A 11: 120,727,082 T23S probably benign Het
Dennd1b T A 1: 139,062,932 H211Q probably damaging Het
Ercc8 G A 13: 108,183,863 A328T probably benign Het
Fam217a T C 13: 34,911,128 D216G possibly damaging Het
Fam26d A T 10: 34,044,049 M74K possibly damaging Het
Fat2 T A 11: 55,310,763 Y495F probably benign Het
Fbxw13 G A 9: 109,195,900 S15F probably damaging Het
Fras1 T A 5: 96,645,103 C964* probably null Het
Fshr T A 17: 88,985,255 H665L probably benign Het
Gm10447 A T 11: 53,456,610 C31S unknown Het
Gm13272 A T 4: 88,780,349 Q167L probably benign Het
Gtpbp2 T C 17: 46,167,787 I510T possibly damaging Het
Hps6 G A 19: 46,004,568 A315T probably benign Het
Igfbp6 A C 15: 102,147,850 T115P probably damaging Het
Ikzf4 A G 10: 128,632,741 V623A possibly damaging Het
Ints1 T C 5: 139,771,085 T493A probably benign Het
Itgax C T 7: 128,135,856 T453I probably benign Het
Kras T C 6: 145,220,628 T183A probably benign Het
Lhcgr T C 17: 88,742,782 T439A probably damaging Het
Lrrn4 T C 2: 132,879,531 H122R probably benign Het
Muc2 A T 7: 141,700,883 R210S possibly damaging Het
Myh7 C G 14: 54,988,801 D461H probably damaging Het
Myo18b T C 5: 112,875,025 D167G unknown Het
Nedd8 G A 14: 55,671,989 probably benign Het
Olfr1442 A C 19: 12,674,976 Y257S probably damaging Het
Pars2 T A 4: 106,654,079 Y353N probably damaging Het
Pbxip1 T A 3: 89,448,101 D642E probably damaging Het
Pcdhb10 A T 18: 37,413,601 R577* probably null Het
Pcna-ps2 T A 19: 9,284,125 Y249* probably null Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Pla2g6 A T 15: 79,287,158 V744E probably damaging Het
Ppfibp1 A G 6: 146,996,405 I207V probably benign Het
Prr11 T C 11: 87,103,607 D71G probably benign Het
Rnf150 A C 8: 82,864,152 Y48S probably damaging Het
Rsf1 G A 7: 97,681,834 G1237D Het
Rusc2 C T 4: 43,416,119 T475I probably benign Het
Scgb1b20 T A 7: 33,373,442 I25N probably damaging Het
Sdr39u1 T C 14: 55,899,659 N65S probably benign Het
Sh3gl3 T C 7: 82,284,086 V219A possibly damaging Het
Shcbp1 A G 8: 4,764,965 F171S probably benign Het
Shq1 A G 6: 100,671,045 F6S probably damaging Het
Slc12a4 C T 8: 105,945,571 R868H possibly damaging Het
Smg6 T C 11: 74,930,619 V572A probably benign Het
Syn3 A G 10: 86,407,670 V135A probably damaging Het
Tarsl2 A T 7: 65,664,969 D425V probably benign Het
Tmem253 A T 14: 52,017,151 Q21L possibly damaging Het
Trpm3 G T 19: 22,918,790 R997L probably damaging Het
Ubr5 G A 15: 37,979,832 A2434V probably null Het
Ugt1a9 A G 1: 88,071,109 T94A probably benign Het
Vmn1r62 A G 7: 5,675,183 probably benign Het
Vmn2r61 T C 7: 42,267,048 C362R probably damaging Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,815,240 probably benign Het
Zfp94 T C 7: 24,303,682 K112E probably benign Het
Zfp954 A T 7: 7,117,890 V47E probably damaging Het
Other mutations in Il11ra1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02681:Il11ra1 APN 4 41768552 missense possibly damaging 0.73
R0013:Il11ra1 UTSW 4 41765060 missense probably damaging 1.00
R0032:Il11ra1 UTSW 4 41768187 missense probably damaging 1.00
R0032:Il11ra1 UTSW 4 41768187 missense probably damaging 1.00
R0365:Il11ra1 UTSW 4 41767527 missense probably damaging 1.00
R0399:Il11ra1 UTSW 4 41766185 missense probably benign 0.03
R1585:Il11ra1 UTSW 4 41768207 missense probably damaging 0.98
R1591:Il11ra1 UTSW 4 41766200 missense probably damaging 1.00
R2424:Il11ra1 UTSW 4 41768222 missense probably damaging 1.00
R3037:Il11ra1 UTSW 4 41765074 missense possibly damaging 0.94
R4393:Il11ra1 UTSW 4 41768577 critical splice donor site probably null
R4770:Il11ra1 UTSW 4 41768187 missense probably damaging 1.00
R4798:Il11ra1 UTSW 4 41766096 unclassified probably benign
R5256:Il11ra1 UTSW 4 41767932 unclassified probably benign
R6005:Il11ra1 UTSW 4 41763887 critical splice donor site probably null
R6309:Il11ra1 UTSW 4 41765279 missense possibly damaging 0.87
R6499:Il11ra1 UTSW 4 41765412 missense probably benign 0.04
R6833:Il11ra1 UTSW 4 41765454 missense probably benign 0.00
R6834:Il11ra1 UTSW 4 41765454 missense probably benign 0.00
R7015:Il11ra1 UTSW 4 41765421 missense probably benign 0.06
R7122:Il11ra1 UTSW 4 41766189 missense probably damaging 0.99
R7275:Il11ra1 UTSW 4 41765109 missense probably damaging 1.00
R8116:Il11ra1 UTSW 4 41766251 missense probably benign 0.27
R8711:Il11ra1 UTSW 4 41767539 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGAACAGTTGTACAGCCCAAC -3'
(R):5'- ATAGTCTACCGCTTGGCAGG -3'

Sequencing Primer
(F):5'- AGTTGTACAGCCCAACCTCGTC -3'
(R):5'- CTTGGCAGGAGACTTCAGGAC -3'
Posted On2019-11-12