Incidental Mutation 'R7710:Rusc2'
ID594520
Institutional Source Beutler Lab
Gene Symbol Rusc2
Ensembl Gene ENSMUSG00000035969
Gene NameRUN and SH3 domain containing 2
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.217) question?
Stock #R7710 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location43381979-43427088 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 43416119 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 475 (T475I)
Ref Sequence ENSEMBL: ENSMUSP00000038379 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035645] [ENSMUST00000098106] [ENSMUST00000125399] [ENSMUST00000131668] [ENSMUST00000135216] [ENSMUST00000136360] [ENSMUST00000139198] [ENSMUST00000144911] [ENSMUST00000149221] [ENSMUST00000152322] [ENSMUST00000173682]
Predicted Effect probably benign
Transcript: ENSMUST00000035645
AA Change: T475I

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000038379
Gene: ENSMUSG00000035969
AA Change: T475I

DomainStartEndE-ValueType
low complexity region 39 47 N/A INTRINSIC
low complexity region 212 230 N/A INTRINSIC
low complexity region 253 265 N/A INTRINSIC
low complexity region 411 427 N/A INTRINSIC
low complexity region 435 448 N/A INTRINSIC
low complexity region 530 544 N/A INTRINSIC
low complexity region 600 617 N/A INTRINSIC
low complexity region 795 809 N/A INTRINSIC
RUN 1109 1177 3.66e-21 SMART
low complexity region 1235 1260 N/A INTRINSIC
low complexity region 1289 1324 N/A INTRINSIC
low complexity region 1330 1341 N/A INTRINSIC
SH3 1457 1512 7.4e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000098106
AA Change: T475I

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000095710
Gene: ENSMUSG00000035969
AA Change: T475I

DomainStartEndE-ValueType
low complexity region 39 47 N/A INTRINSIC
low complexity region 212 230 N/A INTRINSIC
low complexity region 253 265 N/A INTRINSIC
low complexity region 411 427 N/A INTRINSIC
low complexity region 435 448 N/A INTRINSIC
low complexity region 530 544 N/A INTRINSIC
low complexity region 600 617 N/A INTRINSIC
low complexity region 795 809 N/A INTRINSIC
RUN 1109 1177 3.66e-21 SMART
low complexity region 1235 1260 N/A INTRINSIC
low complexity region 1289 1324 N/A INTRINSIC
low complexity region 1330 1341 N/A INTRINSIC
SH3 1457 1512 7.4e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125399
Predicted Effect probably benign
Transcript: ENSMUST00000131668
AA Change: T475I

PolyPhen 2 Score 0.250 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000118528
Gene: ENSMUSG00000035969
AA Change: T475I

DomainStartEndE-ValueType
low complexity region 39 47 N/A INTRINSIC
low complexity region 212 230 N/A INTRINSIC
low complexity region 253 265 N/A INTRINSIC
low complexity region 411 427 N/A INTRINSIC
low complexity region 435 448 N/A INTRINSIC
low complexity region 530 544 N/A INTRINSIC
low complexity region 600 617 N/A INTRINSIC
low complexity region 795 809 N/A INTRINSIC
RUN 1109 1177 3.66e-21 SMART
low complexity region 1235 1260 N/A INTRINSIC
low complexity region 1289 1324 N/A INTRINSIC
low complexity region 1330 1341 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135216
Predicted Effect probably benign
Transcript: ENSMUST00000136360
SMART Domains Protein: ENSMUSP00000123431
Gene: ENSMUSG00000035969

DomainStartEndE-ValueType
low complexity region 39 47 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139198
SMART Domains Protein: ENSMUSP00000121528
Gene: ENSMUSG00000035969

DomainStartEndE-ValueType
low complexity region 39 47 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144911
Predicted Effect probably benign
Transcript: ENSMUST00000149221
Predicted Effect probably benign
Transcript: ENSMUST00000152322
Predicted Effect possibly damaging
Transcript: ENSMUST00000173682
AA Change: T475I

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000133715
Gene: ENSMUSG00000035969
AA Change: T475I

DomainStartEndE-ValueType
low complexity region 39 47 N/A INTRINSIC
low complexity region 212 230 N/A INTRINSIC
low complexity region 253 265 N/A INTRINSIC
low complexity region 411 427 N/A INTRINSIC
low complexity region 435 448 N/A INTRINSIC
low complexity region 530 544 N/A INTRINSIC
low complexity region 685 703 N/A INTRINSIC
low complexity region 733 740 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a RUN and SH3 domain containing protein that interacts with Rab1b and Rab1-binding protein GM130. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Jun 2012]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl1 G A 4: 86,232,573 E151K Het
Ap3b1 T C 13: 94,451,073 S452P probably damaging Het
Cacna2d4 A G 6: 119,274,239 I463V probably benign Het
Ccdc142 T C 6: 83,101,696 S5P probably benign Het
Cd300ld C T 11: 114,984,212 V199M probably damaging Het
Cep162 T C 9: 87,232,119 Y300C probably damaging Het
Ces2h C T 8: 105,000,865 Q5* probably null Het
Col9a3 C T 2: 180,609,365 L310F probably damaging Het
Copa A G 1: 172,109,844 D454G possibly damaging Het
Ctnnbip1 A C 4: 149,545,820 M29L probably benign Het
Ctnnbl1 A G 2: 157,774,571 D64G probably benign Het
Dcxr T A 11: 120,727,082 T23S probably benign Het
Dennd1b T A 1: 139,062,932 H211Q probably damaging Het
Ercc8 G A 13: 108,183,863 A328T probably benign Het
Fam217a T C 13: 34,911,128 D216G possibly damaging Het
Fam26d A T 10: 34,044,049 M74K possibly damaging Het
Fat2 T A 11: 55,310,763 Y495F probably benign Het
Fbxw13 G A 9: 109,195,900 S15F probably damaging Het
Fras1 T A 5: 96,645,103 C964* probably null Het
Fshr T A 17: 88,985,255 H665L probably benign Het
Gm10447 A T 11: 53,456,610 C31S unknown Het
Gm13272 A T 4: 88,780,349 Q167L probably benign Het
Gtpbp2 T C 17: 46,167,787 I510T possibly damaging Het
Hps6 G A 19: 46,004,568 A315T probably benign Het
Igfbp6 A C 15: 102,147,850 T115P probably damaging Het
Ikzf4 A G 10: 128,632,741 V623A possibly damaging Het
Il11ra1 T C 4: 41,764,846 V100A probably benign Het
Ints1 T C 5: 139,771,085 T493A probably benign Het
Itgax C T 7: 128,135,856 T453I probably benign Het
Kras T C 6: 145,220,628 T183A probably benign Het
Lhcgr T C 17: 88,742,782 T439A probably damaging Het
Lrrn4 T C 2: 132,879,531 H122R probably benign Het
Muc2 A T 7: 141,700,883 R210S possibly damaging Het
Myh7 C G 14: 54,988,801 D461H probably damaging Het
Myo18b T C 5: 112,875,025 D167G unknown Het
Nedd8 G A 14: 55,671,989 probably benign Het
Olfr1442 A C 19: 12,674,976 Y257S probably damaging Het
Pars2 T A 4: 106,654,079 Y353N probably damaging Het
Pbxip1 T A 3: 89,448,101 D642E probably damaging Het
Pcdhb10 A T 18: 37,413,601 R577* probably null Het
Pcna-ps2 T A 19: 9,284,125 Y249* probably null Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Pla2g6 A T 15: 79,287,158 V744E probably damaging Het
Ppfibp1 A G 6: 146,996,405 I207V probably benign Het
Prr11 T C 11: 87,103,607 D71G probably benign Het
Rnf150 A C 8: 82,864,152 Y48S probably damaging Het
Rsf1 G A 7: 97,681,834 G1237D Het
Scgb1b20 T A 7: 33,373,442 I25N probably damaging Het
Sdr39u1 T C 14: 55,899,659 N65S probably benign Het
Sh3gl3 T C 7: 82,284,086 V219A possibly damaging Het
Shcbp1 A G 8: 4,764,965 F171S probably benign Het
Shq1 A G 6: 100,671,045 F6S probably damaging Het
Slc12a4 C T 8: 105,945,571 R868H possibly damaging Het
Smg6 T C 11: 74,930,619 V572A probably benign Het
Syn3 A G 10: 86,407,670 V135A probably damaging Het
Tarsl2 A T 7: 65,664,969 D425V probably benign Het
Tmem253 A T 14: 52,017,151 Q21L possibly damaging Het
Trpm3 G T 19: 22,918,790 R997L probably damaging Het
Ubr5 G A 15: 37,979,832 A2434V probably null Het
Ugt1a9 A G 1: 88,071,109 T94A probably benign Het
Vmn1r62 A G 7: 5,675,183 probably benign Het
Vmn2r61 T C 7: 42,267,048 C362R probably damaging Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,815,240 probably benign Het
Zfp94 T C 7: 24,303,682 K112E probably benign Het
Zfp954 A T 7: 7,117,890 V47E probably damaging Het
Other mutations in Rusc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01358:Rusc2 APN 4 43426116 missense probably damaging 0.97
IGL01474:Rusc2 APN 4 43416434 missense probably damaging 0.98
IGL01541:Rusc2 APN 4 43415840 missense probably benign 0.08
IGL01628:Rusc2 APN 4 43425729 missense probably damaging 1.00
IGL01969:Rusc2 APN 4 43415738 missense probably benign 0.02
IGL02030:Rusc2 APN 4 43416095 missense possibly damaging 0.86
IGL02079:Rusc2 APN 4 43425668 missense probably benign
IGL02115:Rusc2 APN 4 43426136 splice site probably benign
IGL02122:Rusc2 APN 4 43421685 missense possibly damaging 0.67
IGL02350:Rusc2 APN 4 43425351 missense possibly damaging 0.86
IGL02357:Rusc2 APN 4 43425351 missense possibly damaging 0.86
IGL02437:Rusc2 APN 4 43415545 missense probably damaging 1.00
IGL02930:Rusc2 APN 4 43416376 missense probably damaging 0.99
IGL03154:Rusc2 APN 4 43425806 missense probably benign 0.00
P0026:Rusc2 UTSW 4 43415840 missense possibly damaging 0.93
R0036:Rusc2 UTSW 4 43424009 missense probably damaging 1.00
R0068:Rusc2 UTSW 4 43424100 splice site probably benign
R0068:Rusc2 UTSW 4 43424100 splice site probably benign
R0114:Rusc2 UTSW 4 43422055 missense probably damaging 1.00
R0255:Rusc2 UTSW 4 43423954 missense probably damaging 1.00
R0471:Rusc2 UTSW 4 43425486 missense probably damaging 0.99
R1381:Rusc2 UTSW 4 43416137 missense probably damaging 1.00
R1413:Rusc2 UTSW 4 43416568 missense probably benign 0.00
R1416:Rusc2 UTSW 4 43421617 missense possibly damaging 0.86
R1731:Rusc2 UTSW 4 43426046 missense probably benign
R1864:Rusc2 UTSW 4 43421719 missense possibly damaging 0.49
R1897:Rusc2 UTSW 4 43421749 missense probably damaging 1.00
R2010:Rusc2 UTSW 4 43415212 missense probably benign 0.06
R2212:Rusc2 UTSW 4 43415935 missense probably damaging 1.00
R2275:Rusc2 UTSW 4 43416260 missense probably damaging 1.00
R2885:Rusc2 UTSW 4 43415456 missense probably benign 0.28
R2886:Rusc2 UTSW 4 43415456 missense probably benign 0.28
R3412:Rusc2 UTSW 4 43415935 missense probably damaging 1.00
R3413:Rusc2 UTSW 4 43415935 missense probably damaging 1.00
R3414:Rusc2 UTSW 4 43415935 missense probably damaging 1.00
R3852:Rusc2 UTSW 4 43416424 missense probably benign 0.45
R4135:Rusc2 UTSW 4 43425563 missense possibly damaging 0.49
R4272:Rusc2 UTSW 4 43415533 missense probably damaging 1.00
R4574:Rusc2 UTSW 4 43416080 missense probably damaging 0.99
R4888:Rusc2 UTSW 4 43423942 missense probably damaging 1.00
R5010:Rusc2 UTSW 4 43415926 missense probably damaging 1.00
R5071:Rusc2 UTSW 4 43415240 missense probably benign 0.05
R5131:Rusc2 UTSW 4 43414948 missense probably benign 0.03
R5177:Rusc2 UTSW 4 43421805 splice site probably null
R5540:Rusc2 UTSW 4 43423975 missense probably damaging 1.00
R5561:Rusc2 UTSW 4 43415932 nonsense probably null
R5628:Rusc2 UTSW 4 43425348 missense probably damaging 1.00
R5645:Rusc2 UTSW 4 43425758 missense probably benign 0.06
R6129:Rusc2 UTSW 4 43424271 missense probably damaging 1.00
R6362:Rusc2 UTSW 4 43416416 missense probably benign 0.30
R6633:Rusc2 UTSW 4 43414852 missense probably damaging 0.99
R6980:Rusc2 UTSW 4 43422846 missense probably benign 0.35
R7491:Rusc2 UTSW 4 43426528 missense probably damaging 1.00
R7641:Rusc2 UTSW 4 43425335 missense possibly damaging 0.84
R7698:Rusc2 UTSW 4 43414900 nonsense probably null
R8052:Rusc2 UTSW 4 43421851 missense probably benign
R8061:Rusc2 UTSW 4 43422492 missense probably damaging 1.00
R8127:Rusc2 UTSW 4 43423747 missense possibly damaging 0.54
R8319:Rusc2 UTSW 4 43425378 missense probably damaging 1.00
R8355:Rusc2 UTSW 4 43422846 missense probably benign 0.35
R8397:Rusc2 UTSW 4 43424206 missense possibly damaging 0.95
R8455:Rusc2 UTSW 4 43422846 missense probably benign 0.35
R8553:Rusc2 UTSW 4 43416508 missense probably benign 0.05
R8725:Rusc2 UTSW 4 43401351 intron probably benign
R8725:Rusc2 UTSW 4 43415396 missense probably damaging 0.99
R8727:Rusc2 UTSW 4 43401351 intron probably benign
X0025:Rusc2 UTSW 4 43422226 missense probably benign 0.00
X0066:Rusc2 UTSW 4 43422204 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTGGCCACACAGAATTACTATAAAC -3'
(R):5'- CCTCACTTAATCGTACTGGGCAAC -3'

Sequencing Primer
(F):5'- TCACAGTCCTCCCCGAG -3'
(R):5'- TCGTACTGGGCAACTAAGC -3'
Posted On2019-11-12