Incidental Mutation 'R7710:Pars2'
ID594523
Institutional Source Beutler Lab
Gene Symbol Pars2
Ensembl Gene ENSMUSG00000043572
Gene Nameprolyl-tRNA synthetase (mitochondrial)(putative)
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.852) question?
Stock #R7710 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location106651069-106655282 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 106654079 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 353 (Y353N)
Ref Sequence ENSEMBL: ENSMUSP00000102393 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058905] [ENSMUST00000106781] [ENSMUST00000106782]
Predicted Effect probably damaging
Transcript: ENSMUST00000058905
AA Change: Y317N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000053160
Gene: ENSMUSG00000043572
AA Change: Y317N

DomainStartEndE-ValueType
Pfam:tRNA-synt_2b 98 268 4.8e-36 PFAM
Pfam:HGTP_anticodon 371 470 8.7e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106781
AA Change: Y353N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102393
Gene: ENSMUSG00000043572
AA Change: Y353N

DomainStartEndE-ValueType
Pfam:tRNA-synt_2b 178 391 4.1e-36 PFAM
Pfam:HGTP_anticodon 407 506 3.9e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106782
SMART Domains Protein: ENSMUSP00000102394
Gene: ENSMUSG00000043572

DomainStartEndE-ValueType
PDB:2I4O|C 63 162 2e-8 PDB
SCOP:d1atia2 95 162 4e-10 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a putative member of the class II family of aminoacyl-tRNA synthetases. These enzymes play a critical role in protein biosynthesis by charging tRNAs with their cognate amino acids. This protein is encoded by the nuclear genome but is likely to be imported to the mitochondrion where it is thought to catalyze the ligation of proline to tRNA molecules. Mutations have been found in this gene in some patients with Alpers syndrome. [provided by RefSeq, Mar 2015]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl1 G A 4: 86,232,573 E151K Het
Ap3b1 T C 13: 94,451,073 S452P probably damaging Het
Cacna2d4 A G 6: 119,274,239 I463V probably benign Het
Ccdc142 T C 6: 83,101,696 S5P probably benign Het
Cd300ld C T 11: 114,984,212 V199M probably damaging Het
Cep162 T C 9: 87,232,119 Y300C probably damaging Het
Ces2h C T 8: 105,000,865 Q5* probably null Het
Col9a3 C T 2: 180,609,365 L310F probably damaging Het
Copa A G 1: 172,109,844 D454G possibly damaging Het
Ctnnbip1 A C 4: 149,545,820 M29L probably benign Het
Ctnnbl1 A G 2: 157,774,571 D64G probably benign Het
Dcxr T A 11: 120,727,082 T23S probably benign Het
Dennd1b T A 1: 139,062,932 H211Q probably damaging Het
Ercc8 G A 13: 108,183,863 A328T probably benign Het
Fam217a T C 13: 34,911,128 D216G possibly damaging Het
Fam26d A T 10: 34,044,049 M74K possibly damaging Het
Fat2 T A 11: 55,310,763 Y495F probably benign Het
Fbxw13 G A 9: 109,195,900 S15F probably damaging Het
Fras1 T A 5: 96,645,103 C964* probably null Het
Fshr T A 17: 88,985,255 H665L probably benign Het
Gm10447 A T 11: 53,456,610 C31S unknown Het
Gm13272 A T 4: 88,780,349 Q167L probably benign Het
Gtpbp2 T C 17: 46,167,787 I510T possibly damaging Het
Hps6 G A 19: 46,004,568 A315T probably benign Het
Igfbp6 A C 15: 102,147,850 T115P probably damaging Het
Ikzf4 A G 10: 128,632,741 V623A possibly damaging Het
Il11ra1 T C 4: 41,764,846 V100A probably benign Het
Ints1 T C 5: 139,771,085 T493A probably benign Het
Itgax C T 7: 128,135,856 T453I probably benign Het
Kras T C 6: 145,220,628 T183A probably benign Het
Lhcgr T C 17: 88,742,782 T439A probably damaging Het
Lrrn4 T C 2: 132,879,531 H122R probably benign Het
Muc2 A T 7: 141,700,883 R210S possibly damaging Het
Myh7 C G 14: 54,988,801 D461H probably damaging Het
Myo18b T C 5: 112,875,025 D167G unknown Het
Nedd8 G A 14: 55,671,989 probably benign Het
Olfr1442 A C 19: 12,674,976 Y257S probably damaging Het
Pbxip1 T A 3: 89,448,101 D642E probably damaging Het
Pcdhb10 A T 18: 37,413,601 R577* probably null Het
Pcna-ps2 T A 19: 9,284,125 Y249* probably null Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Pla2g6 A T 15: 79,287,158 V744E probably damaging Het
Ppfibp1 A G 6: 146,996,405 I207V probably benign Het
Prr11 T C 11: 87,103,607 D71G probably benign Het
Rnf150 A C 8: 82,864,152 Y48S probably damaging Het
Rsf1 G A 7: 97,681,834 G1237D Het
Rusc2 C T 4: 43,416,119 T475I probably benign Het
Scgb1b20 T A 7: 33,373,442 I25N probably damaging Het
Sdr39u1 T C 14: 55,899,659 N65S probably benign Het
Sh3gl3 T C 7: 82,284,086 V219A possibly damaging Het
Shcbp1 A G 8: 4,764,965 F171S probably benign Het
Shq1 A G 6: 100,671,045 F6S probably damaging Het
Slc12a4 C T 8: 105,945,571 R868H possibly damaging Het
Smg6 T C 11: 74,930,619 V572A probably benign Het
Syn3 A G 10: 86,407,670 V135A probably damaging Het
Tarsl2 A T 7: 65,664,969 D425V probably benign Het
Tmem253 A T 14: 52,017,151 Q21L possibly damaging Het
Trpm3 G T 19: 22,918,790 R997L probably damaging Het
Ubr5 G A 15: 37,979,832 A2434V probably null Het
Ugt1a9 A G 1: 88,071,109 T94A probably benign Het
Vmn1r62 A G 7: 5,675,183 probably benign Het
Vmn2r61 T C 7: 42,267,048 C362R probably damaging Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,815,240 probably benign Het
Zfp94 T C 7: 24,303,682 K112E probably benign Het
Zfp954 A T 7: 7,117,890 V47E probably damaging Het
Other mutations in Pars2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Pars2 APN 4 106654050 missense probably damaging 0.99
IGL03358:Pars2 APN 4 106653042 missense probably benign 0.00
PIT4378001:Pars2 UTSW 4 106654293 missense possibly damaging 0.51
R1384:Pars2 UTSW 4 106653716 missense possibly damaging 0.75
R1874:Pars2 UTSW 4 106653716 missense possibly damaging 0.75
R1875:Pars2 UTSW 4 106653716 missense possibly damaging 0.75
R2041:Pars2 UTSW 4 106653617 missense probably damaging 1.00
R4606:Pars2 UTSW 4 106654050 missense probably benign 0.22
R4790:Pars2 UTSW 4 106651111 utr 5 prime probably benign
R4794:Pars2 UTSW 4 106654210 nonsense probably null
R5162:Pars2 UTSW 4 106654538 missense probably benign 0.00
R6066:Pars2 UTSW 4 106654079 missense probably damaging 1.00
R6730:Pars2 UTSW 4 106653431 missense probably damaging 1.00
R6860:Pars2 UTSW 4 106654503 missense probably benign 0.45
R7712:Pars2 UTSW 4 106654079 missense probably damaging 1.00
R7817:Pars2 UTSW 4 106654079 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATGAATTCCAGCTACCAGTGG -3'
(R):5'- CAATCTCTGTGGCTGCTGTC -3'

Sequencing Primer
(F):5'- ATTCCAGCTACCAGTGGACATTGG -3'
(R):5'- CCTTGCTGCCTTTCTTAGGGG -3'
Posted On2019-11-12