Incidental Mutation 'R7710:Kras'
ID594532
Institutional Source Beutler Lab
Gene Symbol Kras
Ensembl Gene ENSMUSG00000030265
Gene NameKirsten rat sarcoma viral oncogene homolog
SynonymsKras-2, Ki-ras, Kras2, K-ras
Accession Numbers

Genbank: NM_021284; MGI: 96680

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7710 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location145216699-145250239 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 145220628 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 183 (T183A)
Ref Sequence ENSEMBL: ENSMUSP00000032399 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032399] [ENSMUST00000039729] [ENSMUST00000111710] [ENSMUST00000111719] [ENSMUST00000111721] [ENSMUST00000111723] [ENSMUST00000111724] [ENSMUST00000111725] [ENSMUST00000111726] [ENSMUST00000156486] [ENSMUST00000203147]
Predicted Effect probably benign
Transcript: ENSMUST00000032399
AA Change: T183A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000032399
Gene: ENSMUSG00000030265
AA Change: T183A

DomainStartEndE-ValueType
RAS 1 166 1.14e-123 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000039729
SMART Domains Protein: ENSMUSP00000039433
Gene: ENSMUSG00000040370

DomainStartEndE-ValueType
Pfam:Complex1_LYR 7 63 2.6e-15 PFAM
Pfam:Complex1_LYR_1 7 74 3.6e-14 PFAM
Pfam:Complex1_LYR_2 9 85 8.2e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111710
SMART Domains Protein: ENSMUSP00000107339
Gene: ENSMUSG00000030265

DomainStartEndE-ValueType
RAS 1 166 3.7e-123 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111719
SMART Domains Protein: ENSMUSP00000107348
Gene: ENSMUSG00000040370

DomainStartEndE-ValueType
Pfam:Complex1_LYR 7 63 2.6e-15 PFAM
Pfam:Complex1_LYR_1 7 74 3.6e-14 PFAM
Pfam:Complex1_LYR_2 9 85 8.2e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111721
SMART Domains Protein: ENSMUSP00000107350
Gene: ENSMUSG00000040370

DomainStartEndE-ValueType
Pfam:Complex1_LYR 7 63 5.5e-15 PFAM
Pfam:Complex1_LYR_1 7 67 5.5e-15 PFAM
Pfam:Complex1_LYR_2 9 85 9.2e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111723
SMART Domains Protein: ENSMUSP00000107352
Gene: ENSMUSG00000040370

DomainStartEndE-ValueType
Pfam:Complex1_LYR 7 63 2.6e-15 PFAM
Pfam:Complex1_LYR_1 7 74 3.6e-14 PFAM
Pfam:Complex1_LYR_2 9 85 8.2e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111724
SMART Domains Protein: ENSMUSP00000107353
Gene: ENSMUSG00000040370

DomainStartEndE-ValueType
Pfam:Complex1_LYR 7 63 2.6e-15 PFAM
Pfam:Complex1_LYR_1 7 74 3.6e-14 PFAM
Pfam:Complex1_LYR_2 9 85 8.2e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111725
SMART Domains Protein: ENSMUSP00000107354
Gene: ENSMUSG00000040370

DomainStartEndE-ValueType
Pfam:Complex1_LYR 7 63 2.6e-15 PFAM
Pfam:Complex1_LYR_1 7 74 3.6e-14 PFAM
Pfam:Complex1_LYR_2 9 85 8.2e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111726
SMART Domains Protein: ENSMUSP00000107355
Gene: ENSMUSG00000040370

DomainStartEndE-ValueType
Pfam:Complex1_LYR 7 63 2.6e-15 PFAM
Pfam:Complex1_LYR_1 7 74 3.6e-14 PFAM
Pfam:Complex1_LYR_2 9 85 8.2e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156486
Predicted Effect unknown
Transcript: ENSMUST00000203147
AA Change: T70A
SMART Domains Protein: ENSMUSP00000145294
Gene: ENSMUSG00000030265
AA Change: T70A

DomainStartEndE-ValueType
small_GTPase 1 53 3.1e-8 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, a Kirsten ras oncogene homolog from the mammalian ras gene family, encodes a protein that is a member of the small GTPase superfamily. A single amino acid substitution is responsible for an activating mutation. The transforming protein that results is implicated in various malignancies, including lung adenocarcinoma, mucinous adenoma, ductal carcinoma of the pancreas and colorectal carcinoma. Alternative splicing leads to variants encoding two isoforms that differ in the C-terminal region. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality, decreased fetal growth, pericardial edema, anemia, and liver hypoplasia. Mice heterozygous for various knock-in alleles exhibit increased tumorigenesis. [provided by MGI curators]
Allele List at MGI

All alleles(26) : Targeted, knock-out(3) Targeted, other(7) Gene trapped(14) Other(2)

Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl1 G A 4: 86,232,573 E151K Het
Ap3b1 T C 13: 94,451,073 S452P probably damaging Het
Cacna2d4 A G 6: 119,274,239 I463V probably benign Het
Ccdc142 T C 6: 83,101,696 S5P probably benign Het
Cd300ld C T 11: 114,984,212 V199M probably damaging Het
Cep162 T C 9: 87,232,119 Y300C probably damaging Het
Ces2h C T 8: 105,000,865 Q5* probably null Het
Col9a3 C T 2: 180,609,365 L310F probably damaging Het
Copa A G 1: 172,109,844 D454G possibly damaging Het
Ctnnbip1 A C 4: 149,545,820 M29L probably benign Het
Ctnnbl1 A G 2: 157,774,571 D64G probably benign Het
Dcxr T A 11: 120,727,082 T23S probably benign Het
Dennd1b T A 1: 139,062,932 H211Q probably damaging Het
Ercc8 G A 13: 108,183,863 A328T probably benign Het
Fam217a T C 13: 34,911,128 D216G possibly damaging Het
Fam26d A T 10: 34,044,049 M74K possibly damaging Het
Fat2 T A 11: 55,310,763 Y495F probably benign Het
Fbxw13 G A 9: 109,195,900 S15F probably damaging Het
Fras1 T A 5: 96,645,103 C964* probably null Het
Fshr T A 17: 88,985,255 H665L probably benign Het
Gm10447 A T 11: 53,456,610 C31S unknown Het
Gm13272 A T 4: 88,780,349 Q167L probably benign Het
Gtpbp2 T C 17: 46,167,787 I510T possibly damaging Het
Hps6 G A 19: 46,004,568 A315T probably benign Het
Igfbp6 A C 15: 102,147,850 T115P probably damaging Het
Ikzf4 A G 10: 128,632,741 V623A possibly damaging Het
Il11ra1 T C 4: 41,764,846 V100A probably benign Het
Ints1 T C 5: 139,771,085 T493A probably benign Het
Itgax C T 7: 128,135,856 T453I probably benign Het
Lhcgr T C 17: 88,742,782 T439A probably damaging Het
Lrrn4 T C 2: 132,879,531 H122R probably benign Het
Muc2 A T 7: 141,700,883 R210S possibly damaging Het
Myh7 C G 14: 54,988,801 D461H probably damaging Het
Myo18b T C 5: 112,875,025 D167G unknown Het
Nedd8 G A 14: 55,671,989 probably benign Het
Olfr1442 A C 19: 12,674,976 Y257S probably damaging Het
Pars2 T A 4: 106,654,079 Y353N probably damaging Het
Pbxip1 T A 3: 89,448,101 D642E probably damaging Het
Pcdhb10 A T 18: 37,413,601 R577* probably null Het
Pcna-ps2 T A 19: 9,284,125 Y249* probably null Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Pla2g6 A T 15: 79,287,158 V744E probably damaging Het
Ppfibp1 A G 6: 146,996,405 I207V probably benign Het
Prr11 T C 11: 87,103,607 D71G probably benign Het
Rnf150 A C 8: 82,864,152 Y48S probably damaging Het
Rsf1 G A 7: 97,681,834 G1237D Het
Rusc2 C T 4: 43,416,119 T475I probably benign Het
Scgb1b20 T A 7: 33,373,442 I25N probably damaging Het
Sdr39u1 T C 14: 55,899,659 N65S probably benign Het
Sh3gl3 T C 7: 82,284,086 V219A possibly damaging Het
Shcbp1 A G 8: 4,764,965 F171S probably benign Het
Shq1 A G 6: 100,671,045 F6S probably damaging Het
Slc12a4 C T 8: 105,945,571 R868H possibly damaging Het
Smg6 T C 11: 74,930,619 V572A probably benign Het
Syn3 A G 10: 86,407,670 V135A probably damaging Het
Tarsl2 A T 7: 65,664,969 D425V probably benign Het
Tmem253 A T 14: 52,017,151 Q21L possibly damaging Het
Trpm3 G T 19: 22,918,790 R997L probably damaging Het
Ubr5 G A 15: 37,979,832 A2434V probably null Het
Ugt1a9 A G 1: 88,071,109 T94A probably benign Het
Vmn1r62 A G 7: 5,675,183 probably benign Het
Vmn2r61 T C 7: 42,267,048 C362R probably damaging Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,815,240 probably benign Het
Zfp94 T C 7: 24,303,682 K112E probably benign Het
Zfp954 A T 7: 7,117,890 V47E probably damaging Het
Other mutations in Kras
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00808:Kras APN 6 145246748 missense probably damaging 1.00
IGL02929:Kras APN 6 145232089 intron probably benign
N/A - 293:Kras UTSW 6 145232214 missense probably benign 0.01
R1463:Kras UTSW 6 145225061 intron probably benign
R1518:Kras UTSW 6 145232251 missense probably benign 0.00
R1603:Kras UTSW 6 145225145 nonsense probably null
R1885:Kras UTSW 6 145232117 missense probably damaging 1.00
R5089:Kras UTSW 6 145225143 missense probably benign 0.00
R5133:Kras UTSW 6 145232153 missense probably benign 0.00
R7876:Kras UTSW 6 145225122 missense probably benign
R8151:Kras UTSW 6 145220634 small deletion probably benign
R8944:Kras UTSW 6 145225127 missense probably benign
R8951:Kras UTSW 6 145220612 missense probably benign
Z1177:Kras UTSW 6 145246772 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTTAAGTCCAAAACCCAGGGAATAC -3'
(R):5'- AGTCTGTCATCTGAGCATGGC -3'

Sequencing Primer
(F):5'- GGGAATACTGGCACTTAGA -3'
(R):5'- TCATCTGAGCATGGCAAGCC -3'
Posted On2019-11-12