Incidental Mutation 'R7710:Rsf1'
ID 594541
Institutional Source Beutler Lab
Gene Symbol Rsf1
Ensembl Gene ENSMUSG00000035623
Gene Name remodeling and spacing factor 1
Synonyms 4832420A03Rik, Hbxap, C030033M12Rik, XAP8, p325
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7710 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 97229103-97341989 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 97331041 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Aspartic acid at position 1237 (G1237D)
Ref Sequence ENSEMBL: ENSMUSP00000102771 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107153] [ENSMUST00000123731] [ENSMUST00000135270]
AlphaFold E9PWW9
Predicted Effect
SMART Domains Protein: ENSMUSP00000102771
Gene: ENSMUSG00000035623
AA Change: G1237D

DomainStartEndE-ValueType
low complexity region 25 38 N/A INTRINSIC
Pfam:WHIM1 88 138 2.2e-10 PFAM
Pfam:WHIM2 140 172 9.4e-8 PFAM
Pfam:WHIM3 178 398 2.5e-27 PFAM
low complexity region 743 758 N/A INTRINSIC
low complexity region 845 859 N/A INTRINSIC
low complexity region 863 872 N/A INTRINSIC
PHD 881 927 1.57e-11 SMART
low complexity region 945 959 N/A INTRINSIC
low complexity region 971 993 N/A INTRINSIC
low complexity region 1011 1030 N/A INTRINSIC
low complexity region 1072 1096 N/A INTRINSIC
low complexity region 1110 1128 N/A INTRINSIC
low complexity region 1133 1152 N/A INTRINSIC
low complexity region 1160 1190 N/A INTRINSIC
low complexity region 1192 1198 N/A INTRINSIC
low complexity region 1234 1248 N/A INTRINSIC
low complexity region 1268 1280 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123731
Predicted Effect probably benign
Transcript: ENSMUST00000135270
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein that interacts with hepatitis B virus X protein (HBX) and facilitates transcription of hepatitis B virus genes by the HBX transcription activator, suggesting a role for this interaction in the virus life cycle. This protein also interacts with SNF2H protein to form the RSF chromatin-remodeling complex, where the SNF2H subunit functions as the nucleosome-dependent ATPase, and this protein as the histone chaperone. [provided by RefSeq, Sep 2011]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl1 G A 4: 86,150,810 (GRCm39) E151K Het
Ap3b1 T C 13: 94,587,581 (GRCm39) S452P probably damaging Het
Cacna2d4 A G 6: 119,251,200 (GRCm39) I463V probably benign Het
Calhm4 A T 10: 33,920,045 (GRCm39) M74K possibly damaging Het
Ccdc142 T C 6: 83,078,677 (GRCm39) S5P probably benign Het
Cd300ld C T 11: 114,875,038 (GRCm39) V199M probably damaging Het
Cep162 T C 9: 87,114,172 (GRCm39) Y300C probably damaging Het
Ces2h C T 8: 105,727,497 (GRCm39) Q5* probably null Het
Col9a3 C T 2: 180,251,158 (GRCm39) L310F probably damaging Het
Copa A G 1: 171,937,411 (GRCm39) D454G possibly damaging Het
Ctnnbip1 A C 4: 149,630,277 (GRCm39) M29L probably benign Het
Ctnnbl1 A G 2: 157,616,491 (GRCm39) D64G probably benign Het
Dcxr T A 11: 120,617,908 (GRCm39) T23S probably benign Het
Dennd1b T A 1: 138,990,670 (GRCm39) H211Q probably damaging Het
Ercc8 G A 13: 108,320,397 (GRCm39) A328T probably benign Het
Fam217a T C 13: 35,095,111 (GRCm39) D216G possibly damaging Het
Fat2 T A 11: 55,201,589 (GRCm39) Y495F probably benign Het
Fbxw13 G A 9: 109,024,968 (GRCm39) S15F probably damaging Het
Fras1 T A 5: 96,792,962 (GRCm39) C964* probably null Het
Fshr T A 17: 89,292,683 (GRCm39) H665L probably benign Het
Gm10447 A T 11: 53,347,437 (GRCm39) C31S unknown Het
Gm13272 A T 4: 88,698,586 (GRCm39) Q167L probably benign Het
Gtpbp2 T C 17: 46,478,713 (GRCm39) I510T possibly damaging Het
Hps6 G A 19: 45,993,007 (GRCm39) A315T probably benign Het
Igfbp6 A C 15: 102,056,285 (GRCm39) T115P probably damaging Het
Ikzf4 A G 10: 128,468,610 (GRCm39) V623A possibly damaging Het
Il11ra1 T C 4: 41,764,846 (GRCm39) V100A probably benign Het
Ints1 T C 5: 139,756,840 (GRCm39) T493A probably benign Het
Itgax C T 7: 127,735,028 (GRCm39) T453I probably benign Het
Kras T C 6: 145,166,354 (GRCm39) T183A probably benign Het
Lhcgr T C 17: 89,050,210 (GRCm39) T439A probably damaging Het
Lrrn4 T C 2: 132,721,451 (GRCm39) H122R probably benign Het
Muc2 A T 7: 141,287,452 (GRCm39) R210S possibly damaging Het
Myh7 C G 14: 55,226,258 (GRCm39) D461H probably damaging Het
Myo18b T C 5: 113,022,891 (GRCm39) D167G unknown Het
Nedd8 G A 14: 55,909,446 (GRCm39) probably benign Het
Or5b94 A C 19: 12,652,340 (GRCm39) Y257S probably damaging Het
Pars2 T A 4: 106,511,276 (GRCm39) Y353N probably damaging Het
Pbxip1 T A 3: 89,355,408 (GRCm39) D642E probably damaging Het
Pcdhb10 A T 18: 37,546,654 (GRCm39) R577* probably null Het
Pcna-ps2 T A 19: 9,261,489 (GRCm39) Y249* probably null Het
Peg10 GC GCTCC 6: 4,756,452 (GRCm39) probably benign Het
Pla2g6 A T 15: 79,171,358 (GRCm39) V744E probably damaging Het
Ppfibp1 A G 6: 146,897,903 (GRCm39) I207V probably benign Het
Prr11 T C 11: 86,994,433 (GRCm39) D71G probably benign Het
Rnf150 A C 8: 83,590,781 (GRCm39) Y48S probably damaging Het
Rusc2 C T 4: 43,416,119 (GRCm39) T475I probably benign Het
Scgb1b20 T A 7: 33,072,867 (GRCm39) I25N probably damaging Het
Sdr39u1 T C 14: 56,137,116 (GRCm39) N65S probably benign Het
Sh3gl3 T C 7: 81,933,294 (GRCm39) V219A possibly damaging Het
Shcbp1 A G 8: 4,814,965 (GRCm39) F171S probably benign Het
Shq1 A G 6: 100,648,006 (GRCm39) F6S probably damaging Het
Slc12a4 C T 8: 106,672,203 (GRCm39) R868H possibly damaging Het
Smg6 T C 11: 74,821,445 (GRCm39) V572A probably benign Het
Syn3 A G 10: 86,243,534 (GRCm39) V135A probably damaging Het
Tars3 A T 7: 65,314,717 (GRCm39) D425V probably benign Het
Tmem253 A T 14: 52,254,608 (GRCm39) Q21L possibly damaging Het
Trpm3 G T 19: 22,896,154 (GRCm39) R997L probably damaging Het
Ubr5 G A 15: 37,980,076 (GRCm39) A2434V probably null Het
Ugt1a9 A G 1: 87,998,831 (GRCm39) T94A probably benign Het
Vmn1r62 A G 7: 5,678,182 (GRCm39) probably benign Het
Vmn2r61 T C 7: 41,916,472 (GRCm39) C362R probably damaging Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,706,067 (GRCm39) probably benign Het
Zfp94 T C 7: 24,003,107 (GRCm39) K112E probably benign Het
Zfp954 A T 7: 7,120,889 (GRCm39) V47E probably damaging Het
Other mutations in Rsf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00650:Rsf1 APN 7 97,331,096 (GRCm39) critical splice donor site probably null 0.00
IGL01160:Rsf1 APN 7 97,334,791 (GRCm39) missense probably damaging 1.00
IGL01780:Rsf1 APN 7 97,313,977 (GRCm39) critical splice donor site probably benign 0.00
IGL01960:Rsf1 APN 7 97,310,782 (GRCm39) missense probably benign 0.00
IGL02487:Rsf1 APN 7 97,288,698 (GRCm39) missense probably damaging 0.99
IGL02814:Rsf1 APN 7 97,310,434 (GRCm39) missense probably damaging 1.00
IGL02972:Rsf1 APN 7 97,310,533 (GRCm39) missense probably benign 0.35
IGL03176:Rsf1 APN 7 97,328,357 (GRCm39) splice site probably benign
IGL03256:Rsf1 APN 7 97,328,211 (GRCm39) missense possibly damaging 0.82
BB011:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
BB014:Rsf1 UTSW 7 97,229,131 (GRCm39) unclassified probably benign
BB018:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
FR4976:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
G1Funyon:Rsf1 UTSW 7 97,311,132 (GRCm39) missense
P0023:Rsf1 UTSW 7 97,311,478 (GRCm39) missense probably damaging 1.00
R0144:Rsf1 UTSW 7 97,285,614 (GRCm39) missense probably damaging 1.00
R0380:Rsf1 UTSW 7 97,229,112 (GRCm39) unclassified probably benign
R0392:Rsf1 UTSW 7 97,328,212 (GRCm39) missense probably benign 0.00
R0422:Rsf1 UTSW 7 97,330,024 (GRCm39) missense probably benign 0.04
R0584:Rsf1 UTSW 7 97,311,335 (GRCm39) missense possibly damaging 0.60
R0636:Rsf1 UTSW 7 97,311,226 (GRCm39) missense possibly damaging 0.74
R0729:Rsf1 UTSW 7 97,328,234 (GRCm39) missense probably damaging 1.00
R0755:Rsf1 UTSW 7 97,229,174 (GRCm39) missense probably damaging 1.00
R0947:Rsf1 UTSW 7 97,318,985 (GRCm39) missense probably damaging 1.00
R1278:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R1376:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R1376:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R1498:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R1525:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R1534:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R1582:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R1591:Rsf1 UTSW 7 97,288,520 (GRCm39) nonsense probably null
R1676:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R1695:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R1710:Rsf1 UTSW 7 97,311,556 (GRCm39) missense possibly damaging 0.50
R1722:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R1764:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R1815:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R1815:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R1815:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R1823:Rsf1 UTSW 7 97,229,117 (GRCm39) unclassified probably benign
R1864:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R1884:Rsf1 UTSW 7 97,229,117 (GRCm39) unclassified probably benign
R1897:Rsf1 UTSW 7 97,229,117 (GRCm39) unclassified probably benign
R1915:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R1928:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R1958:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R1962:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R1962:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R1996:Rsf1 UTSW 7 97,313,839 (GRCm39) missense probably damaging 1.00
R1999:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R2021:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R2022:Rsf1 UTSW 7 97,229,117 (GRCm39) unclassified probably benign
R2046:Rsf1 UTSW 7 97,310,884 (GRCm39) missense probably benign 0.00
R2048:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R2093:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R2103:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R2137:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R2167:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R2179:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R2191:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R2207:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R2211:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R2241:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R2264:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R2283:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R2297:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R2307:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R2419:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R2442:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R2696:Rsf1 UTSW 7 97,229,140 (GRCm39) unclassified probably benign
R2764:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R2939:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R2965:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R2972:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R3008:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R3013:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R3026:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R3110:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R3147:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R3427:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R3610:Rsf1 UTSW 7 97,229,111 (GRCm39) start codon destroyed probably null
R3624:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R3753:Rsf1 UTSW 7 97,311,359 (GRCm39) missense probably benign 0.00
R3759:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R3780:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R3794:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R3889:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R3925:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R3964:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R4037:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R4057:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R4057:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R4084:Rsf1 UTSW 7 97,229,126 (GRCm39) unclassified probably benign
R4240:Rsf1 UTSW 7 97,229,142 (GRCm39) unclassified probably benign
R4303:Rsf1 UTSW 7 97,229,127 (GRCm39) unclassified probably benign
R4383:Rsf1 UTSW 7 97,334,683 (GRCm39) missense possibly damaging 0.86
R4492:Rsf1 UTSW 7 97,229,130 (GRCm39) unclassified probably benign
R4525:Rsf1 UTSW 7 97,229,133 (GRCm39) unclassified probably benign
R4530:Rsf1 UTSW 7 97,229,130 (GRCm39) unclassified probably benign
R4543:Rsf1 UTSW 7 97,229,129 (GRCm39) unclassified probably benign
R4629:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R4629:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R4632:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R4633:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R4652:Rsf1 UTSW 7 97,229,126 (GRCm39) unclassified probably benign
R4675:Rsf1 UTSW 7 97,229,111 (GRCm39) start codon destroyed probably null
R4675:Rsf1 UTSW 7 97,229,117 (GRCm39) unclassified probably benign
R4677:Rsf1 UTSW 7 97,329,980 (GRCm39) missense possibly damaging 0.82
R4678:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R4769:Rsf1 UTSW 7 97,325,429 (GRCm39) missense probably damaging 1.00
R4774:Rsf1 UTSW 7 97,229,123 (GRCm39) unclassified probably benign
R4820:Rsf1 UTSW 7 97,229,126 (GRCm39) unclassified probably benign
R4917:Rsf1 UTSW 7 97,311,612 (GRCm39) missense probably damaging 1.00
R4918:Rsf1 UTSW 7 97,311,612 (GRCm39) missense probably damaging 1.00
R4977:Rsf1 UTSW 7 97,229,123 (GRCm39) unclassified probably benign
R4979:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R4994:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R4994:Rsf1 UTSW 7 97,229,130 (GRCm39) unclassified probably benign
R5041:Rsf1 UTSW 7 97,229,132 (GRCm39) unclassified probably benign
R5125:Rsf1 UTSW 7 97,311,079 (GRCm39) missense possibly damaging 0.87
R5178:Rsf1 UTSW 7 97,311,079 (GRCm39) missense possibly damaging 0.87
R5306:Rsf1 UTSW 7 97,229,136 (GRCm39) unclassified probably benign
R5369:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R5371:Rsf1 UTSW 7 97,229,120 (GRCm39) unclassified probably benign
R5403:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R5436:Rsf1 UTSW 7 97,229,138 (GRCm39) unclassified probably benign
R5450:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R5532:Rsf1 UTSW 7 97,329,902 (GRCm39) missense probably damaging 1.00
R5587:Rsf1 UTSW 7 97,311,328 (GRCm39) missense probably benign 0.02
R5657:Rsf1 UTSW 7 97,229,141 (GRCm39) unclassified probably benign
R5689:Rsf1 UTSW 7 97,229,141 (GRCm39) unclassified probably benign
R5745:Rsf1 UTSW 7 97,229,127 (GRCm39) unclassified probably benign
R5748:Rsf1 UTSW 7 97,229,135 (GRCm39) unclassified probably benign
R5773:Rsf1 UTSW 7 97,229,140 (GRCm39) unclassified probably benign
R5859:Rsf1 UTSW 7 97,334,766 (GRCm39) missense probably damaging 1.00
R5938:Rsf1 UTSW 7 97,334,766 (GRCm39) missense probably damaging 1.00
R6001:Rsf1 UTSW 7 97,229,117 (GRCm39) unclassified probably benign
R6001:Rsf1 UTSW 7 97,229,111 (GRCm39) start codon destroyed probably null
R6001:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R6021:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R6025:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R6030:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R6030:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R6035:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R6035:Rsf1 UTSW 7 97,311,316 (GRCm39) missense probably benign 0.01
R6035:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R6035:Rsf1 UTSW 7 97,311,316 (GRCm39) missense probably benign 0.01
R6036:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R6037:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R6037:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R6073:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R6077:Rsf1 UTSW 7 97,229,135 (GRCm39) unclassified probably benign
R6102:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R6111:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R6126:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R6128:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R6130:Rsf1 UTSW 7 97,229,117 (GRCm39) unclassified probably benign
R6154:Rsf1 UTSW 7 97,229,111 (GRCm39) start codon destroyed probably null
R6154:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R6165:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R6166:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R6182:Rsf1 UTSW 7 97,229,117 (GRCm39) unclassified probably benign
R6189:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R6200:Rsf1 UTSW 7 97,229,132 (GRCm39) unclassified probably benign
R6210:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R6212:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R6214:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R6215:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R6216:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R6232:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R6235:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R6242:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R6243:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R6244:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R6268:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R6269:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R6273:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R6275:Rsf1 UTSW 7 97,229,130 (GRCm39) unclassified probably benign
R6286:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R6291:Rsf1 UTSW 7 97,229,117 (GRCm39) unclassified probably benign
R6293:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R6297:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R6302:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R6309:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R6312:Rsf1 UTSW 7 97,229,111 (GRCm39) start codon destroyed probably null
R6324:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R6343:Rsf1 UTSW 7 97,310,124 (GRCm39) missense probably benign 0.30
R6346:Rsf1 UTSW 7 97,229,111 (GRCm39) start codon destroyed probably null
R6356:Rsf1 UTSW 7 97,311,141 (GRCm39) missense probably benign
R6370:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R6377:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R6377:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R6378:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R6394:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R6398:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R6406:Rsf1 UTSW 7 97,229,133 (GRCm39) unclassified probably benign
R6413:Rsf1 UTSW 7 97,229,117 (GRCm39) unclassified probably benign
R6443:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R6453:Rsf1 UTSW 7 97,229,124 (GRCm39) unclassified probably benign
R6471:Rsf1 UTSW 7 97,229,121 (GRCm39) unclassified probably benign
R6473:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R6497:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R6505:Rsf1 UTSW 7 97,229,117 (GRCm39) unclassified probably benign
R6561:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R6572:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R6607:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R6611:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R6622:Rsf1 UTSW 7 97,229,117 (GRCm39) unclassified probably benign
R6626:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R6636:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R6647:Rsf1 UTSW 7 97,229,117 (GRCm39) unclassified probably benign
R6648:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R6669:Rsf1 UTSW 7 97,229,132 (GRCm39) unclassified probably benign
R6673:Rsf1 UTSW 7 97,229,125 (GRCm39) unclassified probably benign
R6679:Rsf1 UTSW 7 97,229,111 (GRCm39) start codon destroyed probably null
R6685:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R6694:Rsf1 UTSW 7 97,229,135 (GRCm39) unclassified probably benign
R6694:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R6695:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R6697:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R6726:Rsf1 UTSW 7 97,229,117 (GRCm39) unclassified probably benign
R6739:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R6747:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R6751:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R6771:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R6773:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R6787:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R6800:Rsf1 UTSW 7 97,229,139 (GRCm39) unclassified probably benign
R6804:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R6806:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R6815:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R6820:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R6823:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R6829:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R6861:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R6862:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R6869:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R6875:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R6889:Rsf1 UTSW 7 97,229,132 (GRCm39) unclassified probably benign
R6897:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R6960:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R6963:Rsf1 UTSW 7 97,229,117 (GRCm39) unclassified probably benign
R6967:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R6969:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R6977:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R6996:Rsf1 UTSW 7 97,229,118 (GRCm39) unclassified probably benign
R7066:Rsf1 UTSW 7 97,229,125 (GRCm39) unclassified probably benign
R7109:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R7127:Rsf1 UTSW 7 97,229,121 (GRCm39) unclassified probably benign
R7138:Rsf1 UTSW 7 97,319,002 (GRCm39) missense
R7214:Rsf1 UTSW 7 97,229,136 (GRCm39) unclassified probably benign
R7217:Rsf1 UTSW 7 97,229,139 (GRCm39) unclassified probably benign
R7238:Rsf1 UTSW 7 97,229,128 (GRCm39) unclassified probably benign
R7246:Rsf1 UTSW 7 97,229,129 (GRCm39) unclassified probably benign
R7253:Rsf1 UTSW 7 97,229,122 (GRCm39) unclassified probably benign
R7294:Rsf1 UTSW 7 97,229,127 (GRCm39) unclassified probably benign
R7305:Rsf1 UTSW 7 97,229,125 (GRCm39) unclassified probably benign
R7309:Rsf1 UTSW 7 97,229,118 (GRCm39) unclassified probably benign
R7352:Rsf1 UTSW 7 97,229,133 (GRCm39) unclassified probably benign
R7380:Rsf1 UTSW 7 97,229,122 (GRCm39) unclassified probably benign
R7393:Rsf1 UTSW 7 97,229,124 (GRCm39) unclassified probably benign
R7395:Rsf1 UTSW 7 97,229,133 (GRCm39) unclassified probably benign
R7411:Rsf1 UTSW 7 97,229,139 (GRCm39) unclassified probably benign
R7413:Rsf1 UTSW 7 97,229,128 (GRCm39) unclassified probably benign
R7481:Rsf1 UTSW 7 97,229,124 (GRCm39) unclassified probably benign
R7538:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R7541:Rsf1 UTSW 7 97,229,118 (GRCm39) unclassified probably benign
R7545:Rsf1 UTSW 7 97,229,134 (GRCm39) unclassified probably benign
R7574:Rsf1 UTSW 7 97,310,374 (GRCm39) missense
R7578:Rsf1 UTSW 7 97,229,139 (GRCm39) unclassified probably benign
R7599:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R7630:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R7632:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R7711:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R7715:Rsf1 UTSW 7 97,229,119 (GRCm39) unclassified probably benign
R7719:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R7722:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R7729:Rsf1 UTSW 7 97,229,118 (GRCm39) unclassified probably benign
R7734:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R7743:Rsf1 UTSW 7 97,229,139 (GRCm39) unclassified probably benign
R7761:Rsf1 UTSW 7 97,229,127 (GRCm39) unclassified probably benign
R7764:Rsf1 UTSW 7 97,229,134 (GRCm39) unclassified probably benign
R7797:Rsf1 UTSW 7 97,310,692 (GRCm39) missense
R7802:Rsf1 UTSW 7 97,310,979 (GRCm39) missense
R7806:Rsf1 UTSW 7 97,229,127 (GRCm39) unclassified probably benign
R7821:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R7823:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R7824:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R7825:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R7826:Rsf1 UTSW 7 97,310,368 (GRCm39) unclassified probably benign
R7841:Rsf1 UTSW 7 97,229,111 (GRCm39) start codon destroyed probably null
R7854:Rsf1 UTSW 7 97,229,131 (GRCm39) unclassified probably benign
R7862:Rsf1 UTSW 7 97,229,130 (GRCm39) unclassified probably benign
R7893:Rsf1 UTSW 7 97,311,165 (GRCm39) missense
R7923:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R7924:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R7927:Rsf1 UTSW 7 97,229,131 (GRCm39) unclassified probably benign
R7931:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R7951:Rsf1 UTSW 7 97,229,119 (GRCm39) unclassified probably benign
R7957:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R7960:Rsf1 UTSW 7 97,229,124 (GRCm39) unclassified probably benign
R7979:Rsf1 UTSW 7 97,334,920 (GRCm39) missense
R7982:Rsf1 UTSW 7 97,229,139 (GRCm39) unclassified probably benign
R7991:Rsf1 UTSW 7 97,310,540 (GRCm39) missense
R8028:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R8030:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R8042:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R8062:Rsf1 UTSW 7 97,326,594 (GRCm39) missense
R8076:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R8117:Rsf1 UTSW 7 97,288,464 (GRCm39) splice site probably null
R8132:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R8153:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R8155:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R8166:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R8197:Rsf1 UTSW 7 97,229,121 (GRCm39) unclassified probably benign
R8235:Rsf1 UTSW 7 97,325,461 (GRCm39) utr 3 prime probably benign
R8245:Rsf1 UTSW 7 97,229,122 (GRCm39) unclassified probably benign
R8282:Rsf1 UTSW 7 97,229,127 (GRCm39) frame shift probably null
R8301:Rsf1 UTSW 7 97,311,132 (GRCm39) missense
R8315:Rsf1 UTSW 7 97,229,130 (GRCm39) unclassified probably benign
R8343:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R8370:Rsf1 UTSW 7 97,229,136 (GRCm39) unclassified probably benign
R8372:Rsf1 UTSW 7 97,311,624 (GRCm39) missense
R8376:Rsf1 UTSW 7 97,229,124 (GRCm39) unclassified probably benign
R8382:Rsf1 UTSW 7 97,229,124 (GRCm39) unclassified probably benign
R8392:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R8410:Rsf1 UTSW 7 97,229,124 (GRCm39) unclassified probably benign
R8443:Rsf1 UTSW 7 97,266,103 (GRCm39) missense
R8502:Rsf1 UTSW 7 97,229,121 (GRCm39) unclassified probably benign
R8529:Rsf1 UTSW 7 97,320,074 (GRCm39) utr 3 prime probably benign
R8537:Rsf1 UTSW 7 97,229,121 (GRCm39) unclassified probably benign
R8554:Rsf1 UTSW 7 97,229,130 (GRCm39) unclassified probably benign
R8558:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R8735:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R8742:Rsf1 UTSW 7 97,229,121 (GRCm39) unclassified probably benign
R8772:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R8862:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R8866:Rsf1 UTSW 7 97,229,120 (GRCm39) unclassified probably benign
R8889:Rsf1 UTSW 7 97,328,171 (GRCm39) missense
R8889:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R8891:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R8892:Rsf1 UTSW 7 97,328,171 (GRCm39) missense
R8907:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R8907:Rsf1 UTSW 7 97,229,125 (GRCm39) unclassified probably benign
R8913:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R8916:Rsf1 UTSW 7 97,229,140 (GRCm39) unclassified probably benign
R8924:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R8940:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R8946:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R8947:Rsf1 UTSW 7 97,331,059 (GRCm39) unclassified probably benign
R8951:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R8975:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R9033:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R9044:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R9060:Rsf1 UTSW 7 97,229,130 (GRCm39) unclassified probably benign
R9066:Rsf1 UTSW 7 97,229,118 (GRCm39) unclassified probably benign
R9079:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R9080:Rsf1 UTSW 7 97,229,111 (GRCm39) start codon destroyed probably null
R9094:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R9096:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R9101:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R9102:Rsf1 UTSW 7 97,229,138 (GRCm39) unclassified probably benign
R9123:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R9125:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R9126:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R9128:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R9157:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R9159:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R9161:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R9187:Rsf1 UTSW 7 97,229,140 (GRCm39) unclassified probably benign
R9240:Rsf1 UTSW 7 97,229,119 (GRCm39) unclassified probably benign
R9250:Rsf1 UTSW 7 97,229,121 (GRCm39) unclassified probably benign
R9257:Rsf1 UTSW 7 97,334,918 (GRCm39) missense
R9288:Rsf1 UTSW 7 97,229,119 (GRCm39) unclassified probably benign
R9345:Rsf1 UTSW 7 97,229,139 (GRCm39) unclassified probably benign
R9406:Rsf1 UTSW 7 97,229,118 (GRCm39) unclassified probably benign
R9411:Rsf1 UTSW 7 97,229,111 (GRCm39) start codon destroyed probably null
R9414:Rsf1 UTSW 7 97,313,765 (GRCm39) critical splice acceptor site probably null
R9420:Rsf1 UTSW 7 97,229,134 (GRCm39) unclassified probably benign
R9421:Rsf1 UTSW 7 97,229,141 (GRCm39) unclassified probably benign
R9423:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R9427:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R9448:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R9452:Rsf1 UTSW 7 97,229,133 (GRCm39) unclassified probably benign
R9454:Rsf1 UTSW 7 97,229,130 (GRCm39) unclassified probably benign
R9467:Rsf1 UTSW 7 97,229,120 (GRCm39) unclassified probably benign
R9468:Rsf1 UTSW 7 97,229,127 (GRCm39) unclassified probably benign
R9483:Rsf1 UTSW 7 97,229,137 (GRCm39) unclassified probably benign
R9488:Rsf1 UTSW 7 97,229,129 (GRCm39) unclassified probably benign
R9502:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R9507:Rsf1 UTSW 7 97,229,141 (GRCm39) unclassified probably benign
R9509:Rsf1 UTSW 7 97,229,127 (GRCm39) unclassified probably benign
R9519:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R9526:Rsf1 UTSW 7 97,229,139 (GRCm39) unclassified probably benign
R9537:Rsf1 UTSW 7 97,229,121 (GRCm39) unclassified probably benign
R9581:Rsf1 UTSW 7 97,229,125 (GRCm39) unclassified probably benign
R9590:Rsf1 UTSW 7 97,229,118 (GRCm39) unclassified probably benign
R9592:Rsf1 UTSW 7 97,229,118 (GRCm39) unclassified probably benign
R9618:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R9630:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R9685:Rsf1 UTSW 7 97,229,139 (GRCm39) unclassified probably benign
R9716:Rsf1 UTSW 7 97,229,139 (GRCm39) unclassified probably benign
R9748:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R9774:Rsf1 UTSW 7 97,229,138 (GRCm39) unclassified probably benign
R9795:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R9802:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
RF034:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
RF036:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
X0025:Rsf1 UTSW 7 97,285,651 (GRCm39) missense probably damaging 1.00
X0028:Rsf1 UTSW 7 97,310,031 (GRCm39) nonsense probably null
Y4335:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CGTTAGCTAAGTATACTTCTACCAATG -3'
(R):5'- TGAGACTGCTTATCTACTCAGAAC -3'

Sequencing Primer
(F):5'- TTTTGTAGAAACCCGGCG -3'
(R):5'- GCTTATCTACTCAGAACTTAGAAGTG -3'
Posted On 2019-11-12