Incidental Mutation 'R7710:Ces2h'
ID594546
Institutional Source Beutler Lab
Gene Symbol Ces2h
Ensembl Gene ENSMUSG00000091813
Gene Namecarboxylesterase 2H
SynonymsGm5744
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R7710 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location105000853-105021178 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 105000865 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 5 (Q5*)
Ref Sequence ENSEMBL: ENSMUSP00000126773 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172032]
Predicted Effect probably null
Transcript: ENSMUST00000172032
AA Change: Q5*
SMART Domains Protein: ENSMUSP00000126773
Gene: ENSMUSG00000091813
AA Change: Q5*

DomainStartEndE-ValueType
Pfam:COesterase 9 537 2.5e-167 PFAM
Pfam:Abhydrolase_3 142 275 4.1e-11 PFAM
Pfam:Peptidase_S9 161 326 3.3e-8 PFAM
coiled coil region 538 558 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the carboxylesterase large family. The family members are responsible for the hydrolysis or transesterification of various xenobiotics, such as cocaine and heroin, and endogenous substrates with ester, thioester, or amide bonds. They may participate in fatty acyl and cholesterol ester metabolism, and may play a role in the blood-brain barrier system. The protein encoded by this gene is the major intestinal enzyme and functions in intestine drug clearance. Alternatively spliced transcript variants have been found for this gene.[provided by RefSeq, Oct 2010]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl1 G A 4: 86,232,573 E151K Het
Ap3b1 T C 13: 94,451,073 S452P probably damaging Het
Cacna2d4 A G 6: 119,274,239 I463V probably benign Het
Ccdc142 T C 6: 83,101,696 S5P probably benign Het
Cd300ld C T 11: 114,984,212 V199M probably damaging Het
Cep162 T C 9: 87,232,119 Y300C probably damaging Het
Col9a3 C T 2: 180,609,365 L310F probably damaging Het
Copa A G 1: 172,109,844 D454G possibly damaging Het
Ctnnbip1 A C 4: 149,545,820 M29L probably benign Het
Ctnnbl1 A G 2: 157,774,571 D64G probably benign Het
Dcxr T A 11: 120,727,082 T23S probably benign Het
Dennd1b T A 1: 139,062,932 H211Q probably damaging Het
Ercc8 G A 13: 108,183,863 A328T probably benign Het
Fam217a T C 13: 34,911,128 D216G possibly damaging Het
Fam26d A T 10: 34,044,049 M74K possibly damaging Het
Fat2 T A 11: 55,310,763 Y495F probably benign Het
Fbxw13 G A 9: 109,195,900 S15F probably damaging Het
Fras1 T A 5: 96,645,103 C964* probably null Het
Fshr T A 17: 88,985,255 H665L probably benign Het
Gm10447 A T 11: 53,456,610 C31S unknown Het
Gm13272 A T 4: 88,780,349 Q167L probably benign Het
Gtpbp2 T C 17: 46,167,787 I510T possibly damaging Het
Hps6 G A 19: 46,004,568 A315T probably benign Het
Igfbp6 A C 15: 102,147,850 T115P probably damaging Het
Ikzf4 A G 10: 128,632,741 V623A possibly damaging Het
Il11ra1 T C 4: 41,764,846 V100A probably benign Het
Ints1 T C 5: 139,771,085 T493A probably benign Het
Itgax C T 7: 128,135,856 T453I probably benign Het
Kras T C 6: 145,220,628 T183A probably benign Het
Lhcgr T C 17: 88,742,782 T439A probably damaging Het
Lrrn4 T C 2: 132,879,531 H122R probably benign Het
Muc2 A T 7: 141,700,883 R210S possibly damaging Het
Myh7 C G 14: 54,988,801 D461H probably damaging Het
Myo18b T C 5: 112,875,025 D167G unknown Het
Nedd8 G A 14: 55,671,989 probably benign Het
Olfr1442 A C 19: 12,674,976 Y257S probably damaging Het
Pars2 T A 4: 106,654,079 Y353N probably damaging Het
Pbxip1 T A 3: 89,448,101 D642E probably damaging Het
Pcdhb10 A T 18: 37,413,601 R577* probably null Het
Pcna-ps2 T A 19: 9,284,125 Y249* probably null Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Pla2g6 A T 15: 79,287,158 V744E probably damaging Het
Ppfibp1 A G 6: 146,996,405 I207V probably benign Het
Prr11 T C 11: 87,103,607 D71G probably benign Het
Rnf150 A C 8: 82,864,152 Y48S probably damaging Het
Rsf1 G A 7: 97,681,834 G1237D Het
Rusc2 C T 4: 43,416,119 T475I probably benign Het
Scgb1b20 T A 7: 33,373,442 I25N probably damaging Het
Sdr39u1 T C 14: 55,899,659 N65S probably benign Het
Sh3gl3 T C 7: 82,284,086 V219A possibly damaging Het
Shcbp1 A G 8: 4,764,965 F171S probably benign Het
Shq1 A G 6: 100,671,045 F6S probably damaging Het
Slc12a4 C T 8: 105,945,571 R868H possibly damaging Het
Smg6 T C 11: 74,930,619 V572A probably benign Het
Syn3 A G 10: 86,407,670 V135A probably damaging Het
Tarsl2 A T 7: 65,664,969 D425V probably benign Het
Tmem253 A T 14: 52,017,151 Q21L possibly damaging Het
Trpm3 G T 19: 22,918,790 R997L probably damaging Het
Ubr5 G A 15: 37,979,832 A2434V probably null Het
Ugt1a9 A G 1: 88,071,109 T94A probably benign Het
Vmn1r62 A G 7: 5,675,183 probably benign Het
Vmn2r61 T C 7: 42,267,048 C362R probably damaging Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,815,240 probably benign Het
Zfp94 T C 7: 24,303,682 K112E probably benign Het
Zfp954 A T 7: 7,117,890 V47E probably damaging Het
Other mutations in Ces2h
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01530:Ces2h APN 8 105014484 missense probably benign 0.01
IGL02268:Ces2h APN 8 105019940 missense probably benign 0.00
IGL03133:Ces2h APN 8 105016779 missense probably damaging 1.00
R0138:Ces2h UTSW 8 105018061 missense probably benign 0.01
R0294:Ces2h UTSW 8 105016604 missense probably benign 0.01
R0482:Ces2h UTSW 8 105020271 missense possibly damaging 0.48
R0899:Ces2h UTSW 8 105014550 missense probably damaging 1.00
R1232:Ces2h UTSW 8 105014655 missense probably benign 0.38
R1535:Ces2h UTSW 8 105014486 missense probably benign 0.06
R1738:Ces2h UTSW 8 105019065 critical splice donor site probably null
R1748:Ces2h UTSW 8 105017841 missense probably benign 0.00
R1759:Ces2h UTSW 8 105016611 missense probably damaging 1.00
R1778:Ces2h UTSW 8 105014607 missense possibly damaging 0.93
R1833:Ces2h UTSW 8 105020373 missense possibly damaging 0.93
R1999:Ces2h UTSW 8 105020345 missense probably benign 0.03
R2018:Ces2h UTSW 8 105018398 missense probably damaging 1.00
R2076:Ces2h UTSW 8 105019028 missense probably benign
R2261:Ces2h UTSW 8 105016559 missense probably damaging 0.99
R2262:Ces2h UTSW 8 105016559 missense probably damaging 0.99
R2356:Ces2h UTSW 8 105015938 missense probably damaging 0.98
R4453:Ces2h UTSW 8 105014656 critical splice donor site probably null
R4656:Ces2h UTSW 8 105014639 missense possibly damaging 0.80
R4732:Ces2h UTSW 8 105014604 missense probably damaging 0.97
R4733:Ces2h UTSW 8 105014604 missense probably damaging 0.97
R5219:Ces2h UTSW 8 105016646 missense probably damaging 1.00
R5400:Ces2h UTSW 8 105018425 missense probably benign 0.01
R5696:Ces2h UTSW 8 105018979 missense possibly damaging 0.69
R5894:Ces2h UTSW 8 105019026 missense probably benign 0.14
R6688:Ces2h UTSW 8 105017840 missense probably benign
R6711:Ces2h UTSW 8 105018083 missense probably benign 0.22
R6868:Ces2h UTSW 8 105018423 missense probably benign 0.02
R7233:Ces2h UTSW 8 105017456 missense probably damaging 0.99
R7516:Ces2h UTSW 8 105016826 missense probably damaging 1.00
R7735:Ces2h UTSW 8 105014495 missense probably benign 0.01
R7803:Ces2h UTSW 8 105018400 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTTTCACAAGCCCAGTCTGC -3'
(R):5'- GACACTTGCAGAGTATCACACAAG -3'

Sequencing Primer
(F):5'- AAGCCCAGTCTGCTCAGAGTC -3'
(R):5'- TTGCAGAGTATCACACAAGTAAGC -3'
Posted On2019-11-12