Incidental Mutation 'R0032:Tjp2'
ID59455
Institutional Source Beutler Lab
Gene Symbol Tjp2
Ensembl Gene ENSMUSG00000024812
Gene Nametight junction protein 2
SynonymsZO-2
MMRRC Submission 038326-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0032 (G1) of strain 731
Quality Score225
Status Validated
Chromosome19
Chromosomal Location24094523-24225026 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24108695 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Serine at position 821 (L821S)
Ref Sequence ENSEMBL: ENSMUSP00000097154 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099558]
PDB Structure
Solution structure of N-terminal PDZ domain from mouse TJP2 [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000099558
AA Change: L821S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097154
Gene: ENSMUSG00000024812
AA Change: L821S

DomainStartEndE-ValueType
PDZ 19 97 1.25e-15 SMART
low complexity region 163 178 N/A INTRINSIC
low complexity region 181 202 N/A INTRINSIC
low complexity region 209 226 N/A INTRINSIC
low complexity region 253 276 N/A INTRINSIC
PDZ 297 365 8.73e-15 SMART
low complexity region 377 390 N/A INTRINSIC
PDZ 499 572 1.57e-16 SMART
SH3 587 648 1.07e-2 SMART
GuKc 672 861 3.25e-42 SMART
low complexity region 969 980 N/A INTRINSIC
low complexity region 1037 1049 N/A INTRINSIC
coiled coil region 1063 1090 N/A INTRINSIC
Meta Mutation Damage Score 0.8191 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency 100% (89/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zonula occluden that is a member of the membrane-associated guanylate kinase homolog family. The encoded protein functions as a component of the tight junction barrier in epithelial and endothelial cells and is necessary for proper assembly of tight junctions. Mutations in this gene have been identified in patients with hypercholanemia, and genomic duplication of a 270 kb region including this gene causes autosomal dominant deafness-51. Alternatively spliced transcripts encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Homozygous mutation of this gene results in lethality shortly after implantation due to arrest in early gastrulation. Structure and permeability barrier of the apical junctional complex are altered in cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss3 T A 10: 107,123,295 T97S probably benign Het
Adcy1 T C 11: 7,144,729 S552P possibly damaging Het
Arrb1 T C 7: 99,582,265 F9L probably damaging Het
Auts2 G C 5: 131,440,093 D571E probably damaging Het
C2cd3 T A 7: 100,444,445 probably benign Het
Ccbe1 T G 18: 66,291,652 T35P possibly damaging Het
Cct6b G T 11: 82,753,643 T202K possibly damaging Het
Cd86 A T 16: 36,620,873 S77R probably damaging Het
Cdk5rap3 A T 11: 96,908,753 L412Q possibly damaging Het
Cdsn G A 17: 35,555,555 G327D probably damaging Het
Cfap54 C T 10: 92,932,697 R188H probably benign Het
Clca3a2 T A 3: 144,816,733 I176F probably benign Het
Cop1 T C 1: 159,325,036 probably null Het
Cpne8 T A 15: 90,569,568 probably benign Het
Ctsg T A 14: 56,101,739 I21F probably damaging Het
Cyp2j9 T G 4: 96,568,806 N476T possibly damaging Het
Dcaf4 G A 12: 83,535,988 probably benign Het
Dennd4c T C 4: 86,828,150 probably null Het
Des A G 1: 75,362,166 E195G possibly damaging Het
Dicer1 A T 12: 104,704,798 L995* probably null Het
Dnah10 A G 5: 124,800,891 K2623R possibly damaging Het
Dnajc21 G T 15: 10,461,877 T146K probably benign Het
Dnmbp A C 19: 43,902,719 L203R probably damaging Het
Eif4g1 C T 16: 20,685,898 S829F probably damaging Het
Enkur T C 2: 21,189,304 I153V probably benign Het
Epb41l3 G T 17: 69,210,384 probably null Het
Erf T C 7: 25,245,075 Y277C possibly damaging Het
Fstl5 T A 3: 76,648,435 probably benign Het
Fuk G A 8: 110,892,103 T341M possibly damaging Het
Galnt16 T C 12: 80,592,469 V419A probably damaging Het
Gm10226 A G 17: 21,692,056 D66G possibly damaging Het
Gm15821 T A 17: 34,212,225 probably benign Het
Grm3 A G 5: 9,511,452 probably null Het
Il11ra1 A G 4: 41,768,187 E366G probably damaging Het
Impdh2 A G 9: 108,561,661 D71G probably damaging Het
Ipo11 A C 13: 106,834,463 probably benign Het
Ipo8 A G 6: 148,810,711 C261R probably damaging Het
Iqsec3 T C 6: 121,473,130 D145G possibly damaging Het
Itga11 T C 9: 62,774,095 F998L probably benign Het
Junb T C 8: 84,977,786 H215R probably benign Het
Kcnh4 C T 11: 100,746,932 G633E probably benign Het
Kcnn3 CGCAGCAGCAGCAGCAGCAGCAG CGCAGCAGCAGCAGCAGCAG 3: 89,520,665 probably benign Het
Krt73 T C 15: 101,794,052 S459G probably benign Het
Krt74 T A 15: 101,761,452 noncoding transcript Het
Meis3 C A 7: 16,182,285 probably benign Het
Mlh3 A G 12: 85,245,749 probably benign Het
Mroh2a GT GTT 1: 88,256,166 probably null Het
Naip6 C T 13: 100,303,237 E341K probably benign Het
Nbeal2 G T 9: 110,637,868 probably benign Het
Nfx1 T A 4: 41,015,321 V842E probably benign Het
Olfr118 T A 17: 37,672,487 W155R probably damaging Het
Olfr800 T A 10: 129,660,400 V198D probably benign Het
Olfr891 A G 9: 38,180,608 C72R probably damaging Het
Oma1 T A 4: 103,366,012 S465T possibly damaging Het
Opa1 A T 16: 29,615,069 H574L probably damaging Het
Otog T A 7: 46,288,213 L1782* probably null Het
Otog G A 7: 46,304,231 V2638M probably damaging Het
Pcsk5 T C 19: 17,564,815 N804S possibly damaging Het
Pde4a C A 9: 21,201,432 probably benign Het
Pilra T A 5: 137,831,265 D179V probably damaging Het
Piwil1 G A 5: 128,743,280 S247N probably benign Het
Ppp2r1a G A 17: 20,945,584 probably benign Het
Prss58 T G 6: 40,895,699 T158P probably benign Het
Setmar T A 6: 108,076,416 C290* probably null Het
Slc35e3 T C 10: 117,744,932 M156V probably benign Het
Slc4a5 T A 6: 83,273,157 I509N probably damaging Het
Slit2 G A 5: 48,256,856 R938Q probably damaging Het
Snrpn A G 7: 59,985,082 Y168H probably damaging Het
Sycn C T 7: 28,541,292 A128V possibly damaging Het
Synm C A 7: 67,733,927 R1329M possibly damaging Het
Syt8 T C 7: 142,439,189 V152A probably benign Het
Tcp10a T C 17: 7,336,907 M247T probably benign Het
Tppp2 G T 14: 51,919,409 R81L possibly damaging Het
Trim34b A G 7: 104,336,577 D473G possibly damaging Het
Trpc3 A G 3: 36,644,256 I618T probably damaging Het
Trpm5 A T 7: 143,085,241 D264E probably damaging Het
Tuba8 A T 6: 121,225,904 D392V probably benign Het
Vmn1r50 C A 6: 90,107,800 P176T probably damaging Het
Vmn1r76 T C 7: 11,931,267 I7V probably benign Het
Vmn2r26 T A 6: 124,039,899 W441R possibly damaging Het
Vmn2r57 T C 7: 41,399,733 probably null Het
Zc3h4 T A 7: 16,434,640 D891E unknown Het
Zfp120 A T 2: 150,117,592 V270E possibly damaging Het
Znhit1 G C 5: 136,985,047 R8G possibly damaging Het
Other mutations in Tjp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01151:Tjp2 APN 19 24138810 missense possibly damaging 0.89
IGL01412:Tjp2 APN 19 24100775 missense probably damaging 0.99
IGL01681:Tjp2 APN 19 24134849 critical splice donor site probably null
IGL02044:Tjp2 APN 19 24120840 missense probably damaging 1.00
IGL02212:Tjp2 APN 19 24138786 missense probably damaging 1.00
IGL02629:Tjp2 APN 19 24122379 splice site probably benign
IGL02819:Tjp2 APN 19 24114105 missense probably damaging 0.98
IGL02931:Tjp2 APN 19 24096632 missense probably benign 0.11
PIT4402001:Tjp2 UTSW 19 24098129 nonsense probably null
R0667:Tjp2 UTSW 19 24108749 missense probably benign 0.36
R0674:Tjp2 UTSW 19 24131316 missense probably benign 0.37
R0749:Tjp2 UTSW 19 24122272 missense possibly damaging 0.67
R1185:Tjp2 UTSW 19 24131163 missense possibly damaging 0.67
R1185:Tjp2 UTSW 19 24131163 missense possibly damaging 0.67
R1185:Tjp2 UTSW 19 24131163 missense possibly damaging 0.67
R1563:Tjp2 UTSW 19 24132703 missense probably damaging 0.99
R1571:Tjp2 UTSW 19 24100875 missense probably damaging 1.00
R1624:Tjp2 UTSW 19 24131412 missense probably benign 0.01
R1658:Tjp2 UTSW 19 24112947 missense probably damaging 0.99
R1851:Tjp2 UTSW 19 24099535 missense possibly damaging 0.67
R1968:Tjp2 UTSW 19 24111073 missense probably damaging 0.99
R2068:Tjp2 UTSW 19 24122323 missense probably benign 0.22
R2273:Tjp2 UTSW 19 24112807 missense probably benign
R2994:Tjp2 UTSW 19 24112851 missense probably damaging 1.00
R3767:Tjp2 UTSW 19 24100826 missense probably benign 0.01
R3770:Tjp2 UTSW 19 24100826 missense probably benign 0.01
R4077:Tjp2 UTSW 19 24108818 missense possibly damaging 0.90
R4079:Tjp2 UTSW 19 24108818 missense possibly damaging 0.90
R4505:Tjp2 UTSW 19 24108831 missense possibly damaging 0.50
R4720:Tjp2 UTSW 19 24100805 missense probably damaging 1.00
R4739:Tjp2 UTSW 19 24120111 intron probably null
R4745:Tjp2 UTSW 19 24096666 missense possibly damaging 0.56
R4858:Tjp2 UTSW 19 24122120 missense probably damaging 1.00
R5290:Tjp2 UTSW 19 24131204 missense probably benign
R5887:Tjp2 UTSW 19 24096599 missense probably benign
R5988:Tjp2 UTSW 19 24114100 missense probably benign
R6144:Tjp2 UTSW 19 24120073 missense probably damaging 0.99
R6163:Tjp2 UTSW 19 24125704 critical splice donor site probably null
R6183:Tjp2 UTSW 19 24100791 missense probably damaging 0.99
R6242:Tjp2 UTSW 19 24099603 intron probably null
R6683:Tjp2 UTSW 19 24120843 missense probably damaging 0.99
R6866:Tjp2 UTSW 19 24101991 missense probably damaging 0.99
R7025:Tjp2 UTSW 19 24132688 missense probably benign 0.28
R7153:Tjp2 UTSW 19 24101981 missense probably benign 0.40
R7514:Tjp2 UTSW 19 24111522 missense probably benign 0.03
R8004:Tjp2 UTSW 19 24114120 missense probably damaging 1.00
X0066:Tjp2 UTSW 19 24098027 missense probably damaging 1.00
Z1176:Tjp2 UTSW 19 24131365 missense probably benign 0.00
Z1177:Tjp2 UTSW 19 24095460 missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- AGTCTACCTCGGAAATCTAGCGCC -3'
(R):5'- TGGGAGAATAGACCCCTCAGTGATG -3'

Sequencing Primer
(F):5'- GTGTAACATACAACTGCCATAGGTC -3'
(R):5'- AATAGACCCCTCAGTGATGTCTTTG -3'
Posted On2013-07-11