Incidental Mutation 'R7710:Zfp354c'
ID594553
Institutional Source Beutler Lab
Gene Symbol Zfp354c
Ensembl Gene ENSMUSG00000044807
Gene Namezinc finger protein 354C
SynonymsAJ18, Kid3, 5330421P20Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.210) question?
Stock #R7710 (G1)
Quality Score217.468
Status Not validated
Chromosome11
Chromosomal Location50811086-50827724 bp(-) (GRCm38)
Type of Mutationsmall deletion (3 aa in frame mutation)
DNA Base Change (assembly) TCACACTCGGCACA to TCACA at 50815240 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000104763 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000632] [ENSMUST00000109135]
Predicted Effect probably benign
Transcript: ENSMUST00000000632
SMART Domains Protein: ENSMUSP00000000632
Gene: ENSMUSG00000044807

DomainStartEndE-ValueType
KRAB 14 74 9.98e-33 SMART
ZnF_C2H2 218 240 5.9e-3 SMART
ZnF_C2H2 246 268 3.74e-5 SMART
ZnF_C2H2 274 296 1.72e-4 SMART
ZnF_C2H2 302 324 7.78e-3 SMART
ZnF_C2H2 330 352 1.92e-2 SMART
ZnF_C2H2 358 380 4.79e-3 SMART
ZnF_C2H2 386 408 1.1e-2 SMART
ZnF_C2H2 414 436 5.67e-5 SMART
ZnF_C2H2 442 464 9.08e-4 SMART
ZnF_C2H2 470 492 5.59e-4 SMART
ZnF_C2H2 498 520 3.39e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109135
SMART Domains Protein: ENSMUSP00000104763
Gene: ENSMUSG00000044807

DomainStartEndE-ValueType
KRAB 14 74 9.98e-33 SMART
ZnF_C2H2 218 240 5.9e-3 SMART
ZnF_C2H2 246 268 3.74e-5 SMART
ZnF_C2H2 274 296 1.72e-4 SMART
ZnF_C2H2 302 324 7.78e-3 SMART
ZnF_C2H2 330 352 1.92e-2 SMART
ZnF_C2H2 358 380 4.79e-3 SMART
ZnF_C2H2 386 408 1.1e-2 SMART
ZnF_C2H2 414 436 5.67e-5 SMART
ZnF_C2H2 442 464 9.08e-4 SMART
ZnF_C2H2 470 492 5.59e-4 SMART
ZnF_C2H2 498 520 3.39e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl1 G A 4: 86,232,573 E151K Het
Ap3b1 T C 13: 94,451,073 S452P probably damaging Het
Cacna2d4 A G 6: 119,274,239 I463V probably benign Het
Ccdc142 T C 6: 83,101,696 S5P probably benign Het
Cd300ld C T 11: 114,984,212 V199M probably damaging Het
Cep162 T C 9: 87,232,119 Y300C probably damaging Het
Ces2h C T 8: 105,000,865 Q5* probably null Het
Col9a3 C T 2: 180,609,365 L310F probably damaging Het
Copa A G 1: 172,109,844 D454G possibly damaging Het
Ctnnbip1 A C 4: 149,545,820 M29L probably benign Het
Ctnnbl1 A G 2: 157,774,571 D64G probably benign Het
Dcxr T A 11: 120,727,082 T23S probably benign Het
Dennd1b T A 1: 139,062,932 H211Q probably damaging Het
Ercc8 G A 13: 108,183,863 A328T probably benign Het
Fam217a T C 13: 34,911,128 D216G possibly damaging Het
Fam26d A T 10: 34,044,049 M74K possibly damaging Het
Fat2 T A 11: 55,310,763 Y495F probably benign Het
Fbxw13 G A 9: 109,195,900 S15F probably damaging Het
Fras1 T A 5: 96,645,103 C964* probably null Het
Fshr T A 17: 88,985,255 H665L probably benign Het
Gm10447 A T 11: 53,456,610 C31S unknown Het
Gm13272 A T 4: 88,780,349 Q167L probably benign Het
Gtpbp2 T C 17: 46,167,787 I510T possibly damaging Het
Hps6 G A 19: 46,004,568 A315T probably benign Het
Igfbp6 A C 15: 102,147,850 T115P probably damaging Het
Ikzf4 A G 10: 128,632,741 V623A possibly damaging Het
Il11ra1 T C 4: 41,764,846 V100A probably benign Het
Ints1 T C 5: 139,771,085 T493A probably benign Het
Itgax C T 7: 128,135,856 T453I probably benign Het
Kras T C 6: 145,220,628 T183A probably benign Het
Lhcgr T C 17: 88,742,782 T439A probably damaging Het
Lrrn4 T C 2: 132,879,531 H122R probably benign Het
Muc2 A T 7: 141,700,883 R210S possibly damaging Het
Myh7 C G 14: 54,988,801 D461H probably damaging Het
Myo18b T C 5: 112,875,025 D167G unknown Het
Nedd8 G A 14: 55,671,989 probably benign Het
Olfr1442 A C 19: 12,674,976 Y257S probably damaging Het
Pars2 T A 4: 106,654,079 Y353N probably damaging Het
Pbxip1 T A 3: 89,448,101 D642E probably damaging Het
Pcdhb10 A T 18: 37,413,601 R577* probably null Het
Pcna-ps2 T A 19: 9,284,125 Y249* probably null Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Pla2g6 A T 15: 79,287,158 V744E probably damaging Het
Ppfibp1 A G 6: 146,996,405 I207V probably benign Het
Prr11 T C 11: 87,103,607 D71G probably benign Het
Rnf150 A C 8: 82,864,152 Y48S probably damaging Het
Rsf1 G A 7: 97,681,834 G1237D Het
Rusc2 C T 4: 43,416,119 T475I probably benign Het
Scgb1b20 T A 7: 33,373,442 I25N probably damaging Het
Sdr39u1 T C 14: 55,899,659 N65S probably benign Het
Sh3gl3 T C 7: 82,284,086 V219A possibly damaging Het
Shcbp1 A G 8: 4,764,965 F171S probably benign Het
Shq1 A G 6: 100,671,045 F6S probably damaging Het
Slc12a4 C T 8: 105,945,571 R868H possibly damaging Het
Smg6 T C 11: 74,930,619 V572A probably benign Het
Syn3 A G 10: 86,407,670 V135A probably damaging Het
Tarsl2 A T 7: 65,664,969 D425V probably benign Het
Tmem253 A T 14: 52,017,151 Q21L possibly damaging Het
Trpm3 G T 19: 22,918,790 R997L probably damaging Het
Ubr5 G A 15: 37,979,832 A2434V probably null Het
Ugt1a9 A G 1: 88,071,109 T94A probably benign Het
Vmn1r62 A G 7: 5,675,183 probably benign Het
Vmn2r61 T C 7: 42,267,048 C362R probably damaging Het
Zfp94 T C 7: 24,303,682 K112E probably benign Het
Zfp954 A T 7: 7,117,890 V47E probably damaging Het
Other mutations in Zfp354c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00923:Zfp354c APN 11 50815613 missense probably damaging 0.97
IGL01615:Zfp354c APN 11 50817905 missense possibly damaging 0.90
IGL03019:Zfp354c APN 11 50817194 missense probably damaging 1.00
R0546:Zfp354c UTSW 11 50815630 missense probably benign 0.12
R1370:Zfp354c UTSW 11 50815840 missense probably benign
R2109:Zfp354c UTSW 11 50817142 missense probably benign 0.01
R2850:Zfp354c UTSW 11 50815331 nonsense probably null
R4010:Zfp354c UTSW 11 50814944 missense probably damaging 0.98
R5034:Zfp354c UTSW 11 50815039 missense probably benign 0.14
R5430:Zfp354c UTSW 11 50815195 missense probably benign 0.02
R5439:Zfp354c UTSW 11 50815770 missense probably benign 0.01
R5905:Zfp354c UTSW 11 50815426 missense probably damaging 1.00
R6244:Zfp354c UTSW 11 50814971 missense probably benign 0.41
R6264:Zfp354c UTSW 11 50815447 missense probably benign 0.00
R6591:Zfp354c UTSW 11 50814775 missense probably benign 0.41
R6650:Zfp354c UTSW 11 50814691 missense probably damaging 1.00
R6691:Zfp354c UTSW 11 50814775 missense probably benign 0.41
R7087:Zfp354c UTSW 11 50815213 missense probably damaging 1.00
R7313:Zfp354c UTSW 11 50814656 missense probably damaging 1.00
R7467:Zfp354c UTSW 11 50815426 missense probably damaging 1.00
R7619:Zfp354c UTSW 11 50817808 critical splice donor site probably null
R7712:Zfp354c UTSW 11 50815240 small deletion probably benign
R7747:Zfp354c UTSW 11 50815240 small deletion probably benign
R7748:Zfp354c UTSW 11 50815240 small deletion probably benign
R7784:Zfp354c UTSW 11 50815240 small deletion probably benign
R7816:Zfp354c UTSW 11 50815240 small deletion probably benign
R7817:Zfp354c UTSW 11 50815240 small deletion probably benign
R7853:Zfp354c UTSW 11 50815240 small deletion probably benign
R7855:Zfp354c UTSW 11 50815240 small deletion probably benign
R7870:Zfp354c UTSW 11 50815238 small deletion probably benign
R7936:Zfp354c UTSW 11 50815240 small deletion probably benign
R7938:Zfp354c UTSW 11 50815240 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- CACGTGTAAAGGTTCTCCCAC -3'
(R):5'- GCTACGTATCACACTTCAGAGAAAG -3'

Sequencing Primer
(F):5'- GTGTAAAGGTTCTCCCACATTGC -3'
(R):5'- TCTTCTAGAGCACAAGAGGCTTC -3'
Posted On2019-11-12