Incidental Mutation 'R7710:Ubr5'
ID594567
Institutional Source Beutler Lab
Gene Symbol Ubr5
Ensembl Gene ENSMUSG00000037487
Gene Nameubiquitin protein ligase E3 component n-recognin 5
SynonymsEdd, 4432411E13Rik, Edd1
Accession Numbers

NCBI RefSeq: NM_001081359.2, NM_001112721.1; MGI:1918040

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7710 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location37967328-38078854 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 37979832 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 2434 (A2434V)
Ref Sequence ENSEMBL: ENSMUSP00000105965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110336] [ENSMUST00000226414] [ENSMUST00000228333]
Predicted Effect probably null
Transcript: ENSMUST00000110336
AA Change: A2434V
SMART Domains Protein: ENSMUSP00000105965
Gene: ENSMUSG00000037487
AA Change: A2434V

DomainStartEndE-ValueType
low complexity region 94 111 N/A INTRINSIC
low complexity region 129 156 N/A INTRINSIC
Pfam:E3_UbLigase_EDD 179 230 9.7e-35 PFAM
low complexity region 282 323 N/A INTRINSIC
low complexity region 614 628 N/A INTRINSIC
low complexity region 860 870 N/A INTRINSIC
low complexity region 933 950 N/A INTRINSIC
low complexity region 970 999 N/A INTRINSIC
low complexity region 1140 1151 N/A INTRINSIC
ZnF_UBR1 1177 1244 5.42e-27 SMART
low complexity region 1396 1405 N/A INTRINSIC
low complexity region 1524 1537 N/A INTRINSIC
low complexity region 1567 1613 N/A INTRINSIC
low complexity region 1641 1657 N/A INTRINSIC
low complexity region 1662 1687 N/A INTRINSIC
low complexity region 1726 1742 N/A INTRINSIC
low complexity region 1759 1789 N/A INTRINSIC
low complexity region 1879 1890 N/A INTRINSIC
low complexity region 1972 1983 N/A INTRINSIC
low complexity region 1986 1997 N/A INTRINSIC
Blast:HECTc 2271 2313 2e-6 BLAST
low complexity region 2329 2366 N/A INTRINSIC
PolyA 2389 2452 3.97e-33 SMART
HECTc 2432 2798 1e-151 SMART
Predicted Effect probably null
Transcript: ENSMUST00000226414
AA Change: A2440V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably benign
Transcript: ENSMUST00000228333
Meta Mutation Damage Score 0.1227 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype Strain: 3052764
Lethality: E11-E12
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a progestin-induced protein, which belongs to the HECT (homology to E6-AP carboxyl terminus) family. The HECT family proteins function as E3 ubiquitin-protein ligases, targeting specific proteins for ubiquitin-mediated proteolysis. This gene is localized to chromosome 8q22 which is disrupted in a variety of cancers. This gene potentially has a role in regulation of cell proliferation or differentiation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality during organogenesis, impaired growth of the allantois, failure or impairment of chorioallantoic fusion, impaired angiogenesis in the yolk sac and allantois, decreased cell proliferation, and increased apoptosis. [provided by MGI curators]
Allele List at MGI

All alleles(151) : Targeted(3) Gene trapped(148)

Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl1 G A 4: 86,232,573 E151K Het
Ap3b1 T C 13: 94,451,073 S452P probably damaging Het
Cacna2d4 A G 6: 119,274,239 I463V probably benign Het
Ccdc142 T C 6: 83,101,696 S5P probably benign Het
Cd300ld C T 11: 114,984,212 V199M probably damaging Het
Cep162 T C 9: 87,232,119 Y300C probably damaging Het
Ces2h C T 8: 105,000,865 Q5* probably null Het
Col9a3 C T 2: 180,609,365 L310F probably damaging Het
Copa A G 1: 172,109,844 D454G possibly damaging Het
Ctnnbip1 A C 4: 149,545,820 M29L probably benign Het
Ctnnbl1 A G 2: 157,774,571 D64G probably benign Het
Dcxr T A 11: 120,727,082 T23S probably benign Het
Dennd1b T A 1: 139,062,932 H211Q probably damaging Het
Ercc8 G A 13: 108,183,863 A328T probably benign Het
Fam217a T C 13: 34,911,128 D216G possibly damaging Het
Fam26d A T 10: 34,044,049 M74K possibly damaging Het
Fat2 T A 11: 55,310,763 Y495F probably benign Het
Fbxw13 G A 9: 109,195,900 S15F probably damaging Het
Fras1 T A 5: 96,645,103 C964* probably null Het
Fshr T A 17: 88,985,255 H665L probably benign Het
Gm10447 A T 11: 53,456,610 C31S unknown Het
Gm13272 A T 4: 88,780,349 Q167L probably benign Het
Gtpbp2 T C 17: 46,167,787 I510T possibly damaging Het
Hps6 G A 19: 46,004,568 A315T probably benign Het
Igfbp6 A C 15: 102,147,850 T115P probably damaging Het
Ikzf4 A G 10: 128,632,741 V623A possibly damaging Het
Il11ra1 T C 4: 41,764,846 V100A probably benign Het
Ints1 T C 5: 139,771,085 T493A probably benign Het
Itgax C T 7: 128,135,856 T453I probably benign Het
Kras T C 6: 145,220,628 T183A probably benign Het
Lhcgr T C 17: 88,742,782 T439A probably damaging Het
Lrrn4 T C 2: 132,879,531 H122R probably benign Het
Muc2 A T 7: 141,700,883 R210S possibly damaging Het
Myh7 C G 14: 54,988,801 D461H probably damaging Het
Myo18b T C 5: 112,875,025 D167G unknown Het
Nedd8 G A 14: 55,671,989 probably benign Het
Olfr1442 A C 19: 12,674,976 Y257S probably damaging Het
Pars2 T A 4: 106,654,079 Y353N probably damaging Het
Pbxip1 T A 3: 89,448,101 D642E probably damaging Het
Pcdhb10 A T 18: 37,413,601 R577* probably null Het
Pcna-ps2 T A 19: 9,284,125 Y249* probably null Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Pla2g6 A T 15: 79,287,158 V744E probably damaging Het
Ppfibp1 A G 6: 146,996,405 I207V probably benign Het
Prr11 T C 11: 87,103,607 D71G probably benign Het
Rnf150 A C 8: 82,864,152 Y48S probably damaging Het
Rsf1 G A 7: 97,681,834 G1237D Het
Rusc2 C T 4: 43,416,119 T475I probably benign Het
Scgb1b20 T A 7: 33,373,442 I25N probably damaging Het
Sdr39u1 T C 14: 55,899,659 N65S probably benign Het
Sh3gl3 T C 7: 82,284,086 V219A possibly damaging Het
Shcbp1 A G 8: 4,764,965 F171S probably benign Het
Shq1 A G 6: 100,671,045 F6S probably damaging Het
Slc12a4 C T 8: 105,945,571 R868H possibly damaging Het
Smg6 T C 11: 74,930,619 V572A probably benign Het
Syn3 A G 10: 86,407,670 V135A probably damaging Het
Tarsl2 A T 7: 65,664,969 D425V probably benign Het
Tmem253 A T 14: 52,017,151 Q21L possibly damaging Het
Trpm3 G T 19: 22,918,790 R997L probably damaging Het
Ugt1a9 A G 1: 88,071,109 T94A probably benign Het
Vmn1r62 A G 7: 5,675,183 probably benign Het
Vmn2r61 T C 7: 42,267,048 C362R probably damaging Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,815,240 probably benign Het
Zfp94 T C 7: 24,303,682 K112E probably benign Het
Zfp954 A T 7: 7,117,890 V47E probably damaging Het
Other mutations in Ubr5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Ubr5 APN 15 37984036 missense probably damaging 1.00
IGL00548:Ubr5 APN 15 38004321 missense probably benign 0.11
IGL00675:Ubr5 APN 15 38018284 missense possibly damaging 0.84
IGL00770:Ubr5 APN 15 38006541 missense probably benign 0.27
IGL00774:Ubr5 APN 15 38006541 missense probably benign 0.27
IGL00919:Ubr5 APN 15 38040842 missense probably damaging 1.00
IGL00962:Ubr5 APN 15 37985934 missense probably damaging 1.00
IGL01328:Ubr5 APN 15 37981523 missense possibly damaging 0.82
IGL01359:Ubr5 APN 15 37973006 missense probably damaging 0.96
IGL01394:Ubr5 APN 15 38009631 missense possibly damaging 0.90
IGL01674:Ubr5 APN 15 37998379 missense probably damaging 1.00
IGL01981:Ubr5 APN 15 37996598 missense probably benign 0.08
IGL01993:Ubr5 APN 15 37973012 missense probably damaging 0.99
IGL02159:Ubr5 APN 15 37991379 splice site probably benign
IGL02252:Ubr5 APN 15 38024894 missense probably damaging 1.00
IGL02442:Ubr5 APN 15 38037901 missense possibly damaging 0.95
IGL02502:Ubr5 APN 15 38030689 missense probably benign 0.01
IGL02503:Ubr5 APN 15 38018320 missense possibly damaging 0.90
IGL02503:Ubr5 APN 15 38018314 missense probably damaging 0.99
IGL02546:Ubr5 APN 15 38008747 missense probably benign 0.00
IGL02556:Ubr5 APN 15 38002448 missense probably benign 0.18
IGL02647:Ubr5 APN 15 37992082 missense probably damaging 0.99
IGL02679:Ubr5 APN 15 38002314 missense probably benign 0.36
IGL02726:Ubr5 APN 15 38000562 splice site probably benign
IGL02884:Ubr5 APN 15 37998376 missense probably damaging 1.00
IGL02972:Ubr5 APN 15 38041952 missense probably damaging 1.00
IGL03000:Ubr5 APN 15 38024852 missense probably damaging 0.99
IGL03028:Ubr5 APN 15 38047593 missense probably benign 0.00
IGL03057:Ubr5 APN 15 38040906 splice site probably benign
IGL03085:Ubr5 APN 15 38029568 missense probably damaging 1.00
IGL03198:Ubr5 APN 15 38045720 missense probably damaging 1.00
IGL03368:Ubr5 APN 15 37998316 missense probably damaging 0.96
Anchovy UTSW 15 37979832 missense probably null
P0016:Ubr5 UTSW 15 38000578 missense probably damaging 1.00
PIT4142001:Ubr5 UTSW 15 38041909 missense probably damaging 0.98
R0133:Ubr5 UTSW 15 37996571 missense probably damaging 0.98
R0173:Ubr5 UTSW 15 38004675 missense probably damaging 1.00
R0234:Ubr5 UTSW 15 37968493 missense probably damaging 1.00
R0234:Ubr5 UTSW 15 37968493 missense probably damaging 1.00
R0314:Ubr5 UTSW 15 37997187 missense probably damaging 0.99
R0379:Ubr5 UTSW 15 38018957 missense probably benign 0.00
R0390:Ubr5 UTSW 15 38030672 missense probably benign 0.19
R0415:Ubr5 UTSW 15 37972980 missense probably damaging 0.98
R0531:Ubr5 UTSW 15 37991344 missense probably benign 0.34
R0650:Ubr5 UTSW 15 38030807 splice site probably benign
R0720:Ubr5 UTSW 15 37972991 missense probably damaging 0.98
R1183:Ubr5 UTSW 15 37997175 missense possibly damaging 0.71
R1302:Ubr5 UTSW 15 38041479 missense possibly damaging 0.91
R1442:Ubr5 UTSW 15 38014924 splice site probably benign
R1507:Ubr5 UTSW 15 37980870 missense probably damaging 1.00
R1575:Ubr5 UTSW 15 38040841 missense probably damaging 1.00
R1577:Ubr5 UTSW 15 38030730 missense possibly damaging 0.76
R1622:Ubr5 UTSW 15 38009113 unclassified probably benign
R1721:Ubr5 UTSW 15 38041846 missense probably benign 0.18
R1799:Ubr5 UTSW 15 37989377 missense probably damaging 1.00
R1840:Ubr5 UTSW 15 37980917 missense possibly damaging 0.51
R1867:Ubr5 UTSW 15 38041846 missense probably benign 0.18
R1868:Ubr5 UTSW 15 38041846 missense probably benign 0.18
R2065:Ubr5 UTSW 15 38040842 missense probably damaging 1.00
R2107:Ubr5 UTSW 15 37989302 missense probably benign 0.00
R2201:Ubr5 UTSW 15 38002299 missense possibly damaging 0.83
R2261:Ubr5 UTSW 15 37988284 missense probably damaging 0.99
R2441:Ubr5 UTSW 15 37989345 missense probably damaging 0.99
R2512:Ubr5 UTSW 15 38002319 missense probably damaging 1.00
R3008:Ubr5 UTSW 15 38030845 missense probably benign
R3412:Ubr5 UTSW 15 38004235 splice site probably benign
R3898:Ubr5 UTSW 15 37997739 missense probably benign 0.02
R3900:Ubr5 UTSW 15 38019242 missense probably damaging 1.00
R4032:Ubr5 UTSW 15 38024837 missense
R4352:Ubr5 UTSW 15 38041573 missense probably benign 0.31
R4362:Ubr5 UTSW 15 38078403 missense probably damaging 0.99
R4467:Ubr5 UTSW 15 38004336 missense probably damaging 1.00
R4507:Ubr5 UTSW 15 38013542 missense probably damaging 0.96
R4683:Ubr5 UTSW 15 38037967 missense probably damaging 1.00
R4771:Ubr5 UTSW 15 38018297 missense possibly damaging 0.50
R4878:Ubr5 UTSW 15 38006564 missense probably benign 0.01
R4999:Ubr5 UTSW 15 38009668 missense probably benign 0.06
R5057:Ubr5 UTSW 15 38004109 missense probably damaging 0.98
R5177:Ubr5 UTSW 15 38006517 missense probably benign 0.22
R5186:Ubr5 UTSW 15 37997916 missense probably damaging 0.99
R5378:Ubr5 UTSW 15 37989578 missense probably damaging 1.00
R5486:Ubr5 UTSW 15 38008739 missense probably benign 0.00
R5494:Ubr5 UTSW 15 38019281 missense possibly damaging 0.78
R5617:Ubr5 UTSW 15 38030657 missense possibly damaging 0.47
R5636:Ubr5 UTSW 15 37983996 missense probably damaging 1.00
R5655:Ubr5 UTSW 15 38015093 missense probably damaging 0.99
R5715:Ubr5 UTSW 15 38002233 missense probably benign 0.06
R5781:Ubr5 UTSW 15 38006541 missense probably benign 0.27
R6645:Ubr5 UTSW 15 38029506 missense probably damaging 1.00
R6774:Ubr5 UTSW 15 38015135 missense probably damaging 1.00
R6823:Ubr5 UTSW 15 37989598 missense probably benign 0.08
R6877:Ubr5 UTSW 15 38002570 missense probably damaging 0.98
R7105:Ubr5 UTSW 15 38008775 missense
R7166:Ubr5 UTSW 15 37976145 missense
R7514:Ubr5 UTSW 15 37988237 missense
R7523:Ubr5 UTSW 15 38004055 missense
R7631:Ubr5 UTSW 15 38029507 missense
R7709:Ubr5 UTSW 15 37979832 missense probably null
R7712:Ubr5 UTSW 15 37979832 missense probably null
R7803:Ubr5 UTSW 15 37979832 missense probably null
R7816:Ubr5 UTSW 15 37979832 missense probably null
R7817:Ubr5 UTSW 15 37979832 missense probably null
R7821:Ubr5 UTSW 15 37997187 missense probably damaging 0.96
R7824:Ubr5 UTSW 15 37991322 missense probably damaging 0.97
R7841:Ubr5 UTSW 15 37980906 missense
R7869:Ubr5 UTSW 15 37979832 missense probably null
R7896:Ubr5 UTSW 15 38041573 missense probably benign 0.31
R8191:Ubr5 UTSW 15 38006507 missense
R8342:Ubr5 UTSW 15 38024837 missense
RF024:Ubr5 UTSW 15 38028652 missense
X0024:Ubr5 UTSW 15 37992060 missense probably damaging 1.00
Z1177:Ubr5 UTSW 15 38040755 missense
Predicted Primers PCR Primer
(F):5'- GCACTTATGTATTTGAAGACACCAC -3'
(R):5'- AGCCTTGCTAGTCACAAGAC -3'

Sequencing Primer
(F):5'- AACCTAAGGCCTCTGGGAG -3'
(R):5'- AGACAGTTGTGTTTCTTTAGCTTTTC -3'
Posted On2019-11-12