Incidental Mutation 'R7710:Fshr'
ID594572
Institutional Source Beutler Lab
Gene Symbol Fshr
Ensembl Gene ENSMUSG00000032937
Gene Namefollicle stimulating hormone receptor
SynonymsFSH-R, Follitropin receptor, follicle-stimulating hormone receptor
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7710 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location88985170-89200612 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 88985255 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 665 (H665L)
Ref Sequence ENSEMBL: ENSMUSP00000040477 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035701]
Predicted Effect probably benign
Transcript: ENSMUST00000035701
AA Change: H665L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000040477
Gene: ENSMUSG00000032937
AA Change: H665L

DomainStartEndE-ValueType
LRRNT 17 50 3.93e-3 SMART
Pfam:LRR_5 134 249 9e-7 PFAM
Pfam:GnHR_trans 282 348 4.6e-27 PFAM
Pfam:7tm_1 378 625 1.9e-30 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to family 1 of G-protein coupled receptors. It is the receptor for follicle stimulating hormone and functions in gonad development. Mutations in this gene cause ovarian dysgenesis type 1, and also ovarian hyperstimulation syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2010]
PHENOTYPE: Homozygous null mutant females are sterile with small ovaries, blocked follicular development, atrophic uterus and imperforate vagina. Mutant males are fertile despite reduction in testis weight, oligozoospermia and reduced testosterone levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl1 G A 4: 86,232,573 E151K Het
Ap3b1 T C 13: 94,451,073 S452P probably damaging Het
Cacna2d4 A G 6: 119,274,239 I463V probably benign Het
Ccdc142 T C 6: 83,101,696 S5P probably benign Het
Cd300ld C T 11: 114,984,212 V199M probably damaging Het
Cep162 T C 9: 87,232,119 Y300C probably damaging Het
Ces2h C T 8: 105,000,865 Q5* probably null Het
Col9a3 C T 2: 180,609,365 L310F probably damaging Het
Copa A G 1: 172,109,844 D454G possibly damaging Het
Ctnnbip1 A C 4: 149,545,820 M29L probably benign Het
Ctnnbl1 A G 2: 157,774,571 D64G probably benign Het
Dcxr T A 11: 120,727,082 T23S probably benign Het
Dennd1b T A 1: 139,062,932 H211Q probably damaging Het
Ercc8 G A 13: 108,183,863 A328T probably benign Het
Fam217a T C 13: 34,911,128 D216G possibly damaging Het
Fam26d A T 10: 34,044,049 M74K possibly damaging Het
Fat2 T A 11: 55,310,763 Y495F probably benign Het
Fbxw13 G A 9: 109,195,900 S15F probably damaging Het
Fras1 T A 5: 96,645,103 C964* probably null Het
Gm10447 A T 11: 53,456,610 C31S unknown Het
Gm13272 A T 4: 88,780,349 Q167L probably benign Het
Gtpbp2 T C 17: 46,167,787 I510T possibly damaging Het
Hps6 G A 19: 46,004,568 A315T probably benign Het
Igfbp6 A C 15: 102,147,850 T115P probably damaging Het
Ikzf4 A G 10: 128,632,741 V623A possibly damaging Het
Il11ra1 T C 4: 41,764,846 V100A probably benign Het
Ints1 T C 5: 139,771,085 T493A probably benign Het
Itgax C T 7: 128,135,856 T453I probably benign Het
Kras T C 6: 145,220,628 T183A probably benign Het
Lhcgr T C 17: 88,742,782 T439A probably damaging Het
Lrrn4 T C 2: 132,879,531 H122R probably benign Het
Muc2 A T 7: 141,700,883 R210S possibly damaging Het
Myh7 C G 14: 54,988,801 D461H probably damaging Het
Myo18b T C 5: 112,875,025 D167G unknown Het
Nedd8 G A 14: 55,671,989 probably benign Het
Olfr1442 A C 19: 12,674,976 Y257S probably damaging Het
Pars2 T A 4: 106,654,079 Y353N probably damaging Het
Pbxip1 T A 3: 89,448,101 D642E probably damaging Het
Pcdhb10 A T 18: 37,413,601 R577* probably null Het
Pcna-ps2 T A 19: 9,284,125 Y249* probably null Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Pla2g6 A T 15: 79,287,158 V744E probably damaging Het
Ppfibp1 A G 6: 146,996,405 I207V probably benign Het
Prr11 T C 11: 87,103,607 D71G probably benign Het
Rnf150 A C 8: 82,864,152 Y48S probably damaging Het
Rsf1 G A 7: 97,681,834 G1237D Het
Rusc2 C T 4: 43,416,119 T475I probably benign Het
Scgb1b20 T A 7: 33,373,442 I25N probably damaging Het
Sdr39u1 T C 14: 55,899,659 N65S probably benign Het
Sh3gl3 T C 7: 82,284,086 V219A possibly damaging Het
Shcbp1 A G 8: 4,764,965 F171S probably benign Het
Shq1 A G 6: 100,671,045 F6S probably damaging Het
Slc12a4 C T 8: 105,945,571 R868H possibly damaging Het
Smg6 T C 11: 74,930,619 V572A probably benign Het
Syn3 A G 10: 86,407,670 V135A probably damaging Het
Tarsl2 A T 7: 65,664,969 D425V probably benign Het
Tmem253 A T 14: 52,017,151 Q21L possibly damaging Het
Trpm3 G T 19: 22,918,790 R997L probably damaging Het
Ubr5 G A 15: 37,979,832 A2434V probably null Het
Ugt1a9 A G 1: 88,071,109 T94A probably benign Het
Vmn1r62 A G 7: 5,675,183 probably benign Het
Vmn2r61 T C 7: 42,267,048 C362R probably damaging Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,815,240 probably benign Het
Zfp94 T C 7: 24,303,682 K112E probably benign Het
Zfp954 A T 7: 7,117,890 V47E probably damaging Het
Other mutations in Fshr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Fshr APN 17 88986191 missense probably damaging 1.00
IGL00272:Fshr APN 17 88985271 missense probably benign 0.00
IGL01067:Fshr APN 17 88985393 missense possibly damaging 0.95
IGL02093:Fshr APN 17 89001889 splice site probably null
IGL03184:Fshr APN 17 89046640 missense possibly damaging 0.80
IGL03383:Fshr APN 17 89046699 missense possibly damaging 0.69
IGL03383:Fshr APN 17 88985693 missense probably damaging 0.98
benedict UTSW 17 88985469 missense probably damaging 1.00
incremental UTSW 17 88985986 missense probably damaging 1.00
positively UTSW 17 88988607 missense probably damaging 1.00
R0056:Fshr UTSW 17 88988457 missense probably damaging 1.00
R0119:Fshr UTSW 17 89009285 missense probably benign 0.34
R0299:Fshr UTSW 17 89009285 missense probably benign 0.34
R0499:Fshr UTSW 17 89009285 missense probably benign 0.34
R0550:Fshr UTSW 17 89045125 missense probably benign 0.00
R1499:Fshr UTSW 17 88986101 missense probably damaging 1.00
R1656:Fshr UTSW 17 89200581 missense unknown
R2435:Fshr UTSW 17 89200596 missense unknown
R3730:Fshr UTSW 17 89001715 missense probably benign 0.00
R3928:Fshr UTSW 17 88985534 missense probably damaging 1.00
R4065:Fshr UTSW 17 88985966 missense probably damaging 1.00
R4625:Fshr UTSW 17 88985720 missense probably damaging 1.00
R5062:Fshr UTSW 17 88986046 nonsense probably null
R5103:Fshr UTSW 17 89097368 missense possibly damaging 0.88
R5212:Fshr UTSW 17 88986256 missense probably benign 0.00
R5212:Fshr UTSW 17 88986257 missense probably benign 0.04
R5311:Fshr UTSW 17 89011013 critical splice donor site probably null
R5456:Fshr UTSW 17 88986348 missense probably benign
R5478:Fshr UTSW 17 89001715 missense probably benign 0.00
R5577:Fshr UTSW 17 88985923 missense probably benign 0.00
R5651:Fshr UTSW 17 88985829 missense possibly damaging 0.62
R5715:Fshr UTSW 17 88986396 critical splice acceptor site probably null
R5750:Fshr UTSW 17 88986241 missense probably benign 0.01
R5797:Fshr UTSW 17 89011075 missense probably damaging 1.00
R6041:Fshr UTSW 17 88985986 missense probably damaging 1.00
R6306:Fshr UTSW 17 89200533 missense probably null 0.00
R6589:Fshr UTSW 17 88988607 missense probably damaging 1.00
R6955:Fshr UTSW 17 88985466 missense probably benign 0.00
R7080:Fshr UTSW 17 89097111 intron probably null
R7139:Fshr UTSW 17 88986161 missense possibly damaging 0.46
R7196:Fshr UTSW 17 88985469 missense probably damaging 1.00
R7197:Fshr UTSW 17 88985469 missense probably damaging 1.00
R7289:Fshr UTSW 17 88985844 missense probably benign 0.35
R7480:Fshr UTSW 17 88985374 nonsense probably null
R7562:Fshr UTSW 17 88988497 missense probably damaging 1.00
R7742:Fshr UTSW 17 88986162 missense probably benign
R7821:Fshr UTSW 17 88986213 missense probably damaging 0.99
R8043:Fshr UTSW 17 88986390 missense probably benign 0.06
Z1176:Fshr UTSW 17 89046667 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATCTGCCATGCACATACCTAG -3'
(R):5'- AGGCCAAGATCCTCCTAGTTC -3'

Sequencing Primer
(F):5'- GTCTTTCAAGGTGAGGATCC -3'
(R):5'- GGCCAAGATCCTCCTAGTTCTGTTC -3'
Posted On2019-11-12