Incidental Mutation 'R7711:Col19a1'
ID594578
Institutional Source Beutler Lab
Gene Symbol Col19a1
Ensembl Gene ENSMUSG00000026141
Gene Namecollagen, type XIX, alpha 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7711 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location24261890-24587472 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24530008 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 220 (I220V)
Ref Sequence ENSEMBL: ENSMUSP00000110899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051344] [ENSMUST00000115244]
Predicted Effect unknown
Transcript: ENSMUST00000051344
AA Change: I220V
SMART Domains Protein: ENSMUSP00000052606
Gene: ENSMUSG00000026141
AA Change: I220V

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
TSPN 47 231 1.61e-63 SMART
low complexity region 254 266 N/A INTRINSIC
Pfam:Collagen 288 349 1e-9 PFAM
Pfam:Collagen 325 391 2.2e-10 PFAM
Pfam:Collagen 376 442 1.4e-8 PFAM
Pfam:Collagen 436 500 2.9e-9 PFAM
Pfam:Collagen 474 536 6.3e-10 PFAM
Pfam:Collagen 519 579 5.6e-10 PFAM
Pfam:Collagen 559 620 1.2e-8 PFAM
Pfam:Collagen 619 675 8.7e-11 PFAM
Pfam:Collagen 697 774 2.4e-8 PFAM
Pfam:Collagen 753 819 8.7e-10 PFAM
Pfam:Collagen 831 892 8.8e-12 PFAM
internal_repeat_2 905 943 3.52e-11 PROSPERO
internal_repeat_1 905 980 8.61e-26 PROSPERO
internal_repeat_2 947 982 3.52e-11 PROSPERO
low complexity region 983 1003 N/A INTRINSIC
low complexity region 1030 1042 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000115244
AA Change: I220V
SMART Domains Protein: ENSMUSP00000110899
Gene: ENSMUSG00000026141
AA Change: I220V

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
TSPN 47 231 1.61e-63 SMART
low complexity region 254 266 N/A INTRINSIC
Pfam:Collagen 288 347 3.1e-9 PFAM
Pfam:Collagen 330 391 1.1e-9 PFAM
internal_repeat_4 455 492 1.88e-5 PROSPERO
Pfam:Collagen 519 579 2e-9 PFAM
Pfam:Collagen 559 620 4.9e-8 PFAM
Pfam:Collagen 619 675 3.5e-10 PFAM
low complexity region 723 741 N/A INTRINSIC
Pfam:Collagen 753 819 2.8e-9 PFAM
Pfam:Collagen 831 892 3.9e-11 PFAM
internal_repeat_2 905 943 1.18e-11 PROSPERO
internal_repeat_1 905 980 8.89e-27 PROSPERO
internal_repeat_2 947 982 1.18e-11 PROSPERO
low complexity region 983 1003 N/A INTRINSIC
low complexity region 1048 1069 N/A INTRINSIC
low complexity region 1078 1115 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha chain of type XIX collagen, a member of the FACIT collagen family (fibril-associated collagens with interrupted helices). Although the function of this collagen is not known, other members of this collagen family are found in association with fibril-forming collagens such as type I and II, and serve to maintain the integrity of the extracellular matrix. The transcript produced from this gene has an unusually large 3' UTR which has not been completely sequenced. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display postnatal lethality resulting from impaired swallowing, abnormal esophageal muscle development, and impaired muscle relaxation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik G A 8: 120,159,984 E342K possibly damaging Het
9430015G10Rik T G 4: 156,119,192 V34G probably damaging Het
Alkbh3 T C 2: 94,008,092 S44G probably benign Het
Alpk2 A T 18: 65,306,484 C613S probably benign Het
Aplp2 G A 9: 31,161,349 R488C probably damaging Het
Arid1b A G 17: 5,336,820 N1463S probably benign Het
Atxn2l A T 7: 126,501,269 L125Q probably damaging Het
C130060K24Rik A G 6: 65,441,373 H23R Het
Cd3d A G 9: 44,986,336 K172E probably benign Het
Chd7 T A 4: 8,805,234 D764E probably benign Het
Cpq T C 15: 33,497,347 I411T probably benign Het
Crybg2 C A 4: 134,065,533 H160N probably benign Het
Cryl1 A T 14: 57,275,556 C285S probably benign Het
Dapk1 A G 13: 60,761,551 D1326G probably damaging Het
Dgkh A G 14: 78,725,019 V24A probably benign Het
Dnajb4 A C 3: 152,186,517 S226R probably benign Het
Dnm3 A T 1: 161,992,053 I850N possibly damaging Het
Dtna G T 18: 23,625,196 probably null Het
Efcab6 G T 15: 83,949,924 D494E probably benign Het
Fam169a G T 13: 97,126,688 E550* probably null Het
Fbxw7 A G 3: 84,925,681 N10S probably benign Het
Flrt2 T C 12: 95,780,754 F622S probably damaging Het
Gm17359 A G 3: 79,405,860 I80M probably damaging Het
Gm884 G T 11: 103,614,912 Q2077K probably benign Het
Gm906 T G 13: 50,247,095 R398S probably benign Het
Gprc5d G A 6: 135,116,357 T184I possibly damaging Het
Grem2 A G 1: 174,837,127 V52A probably damaging Het
Gtf3c2 G T 5: 31,170,189 T310N probably damaging Het
H2-Bl T A 17: 36,083,878 N51I probably damaging Het
Hyou1 A G 9: 44,384,462 D338G possibly damaging Het
Ifna6 T C 4: 88,827,734 S107P probably benign Het
Kif14 G T 1: 136,471,453 G451C probably benign Het
Kit T A 5: 75,637,359 F436I probably damaging Het
Lonp2 G A 8: 86,714,008 C751Y probably damaging Het
Lonrf1 C A 8: 36,249,221 G87C probably damaging Het
Lrp2 T C 2: 69,479,343 probably null Het
Mkln1 A G 6: 31,492,649 H598R probably damaging Het
Mmaa T C 8: 79,268,145 H344R probably benign Het
Myh7 C G 14: 54,988,801 D461H probably damaging Het
Myh7b T G 2: 155,620,403 L342R probably damaging Het
Olfr1120 A G 2: 87,357,527 N28D probably benign Het
Olfr1291-ps1 T A 2: 111,500,152 I300K probably damaging Het
Olfr18 A T 9: 20,314,023 V299E possibly damaging Het
Olfr753-ps1 C T 17: 37,169,956 G129R probably damaging Het
Pcsk5 T A 19: 17,439,080 Y1668F possibly damaging Het
Pfn4 C T 12: 4,774,414 T47I possibly damaging Het
Pklr T C 3: 89,141,342 L104P probably damaging Het
Plcxd2 A G 16: 45,980,330 V177A probably benign Het
Pramef25 T C 4: 143,949,252 S335G probably benign Het
Prdm10 G T 9: 31,357,232 A826S probably damaging Het
Prrt4 A G 6: 29,177,456 S105P probably benign Het
Prss51 T A 14: 64,097,488 V164E probably damaging Het
Psap T C 10: 60,299,855 V360A probably damaging Het
Psg22 T C 7: 18,718,342 probably null Het
Rad51 A G 2: 119,131,590 Q206R probably benign Het
Rap1gds1 T C 3: 138,959,113 K277R probably benign Het
Rassf2 T A 2: 132,005,377 T103S probably benign Het
Rbm15b T A 9: 106,885,943 H342L possibly damaging Het
Rsf1 G GACCGCGGCC 7: 97,579,909 probably benign Het
Scaf8 T C 17: 3,187,634 F561L probably damaging Het
Scn1a G A 2: 66,303,660 A130V probably benign Het
Scn7a T C 2: 66,700,877 E552G probably damaging Het
Slc39a14 T A 14: 70,313,675 R183W probably damaging Het
Slfn1 A T 11: 83,121,263 K68N possibly damaging Het
Slx4ip A G 2: 137,067,994 D303G probably damaging Het
Snx17 T A 5: 31,195,460 F101Y probably damaging Het
Specc1l C A 10: 75,230,808 N30K probably benign Het
Tbx19 A G 1: 165,139,199 S369P probably benign Het
Usp17ld T C 7: 103,250,282 H481R probably damaging Het
Wnt2 A G 6: 17,990,037 L287P probably benign Het
Zfhx4 G T 3: 5,396,956 M1230I probably damaging Het
Zfp1 T C 8: 111,670,162 C272R not run Het
Zfp458 A G 13: 67,259,600 S64P possibly damaging Het
Other mutations in Col19a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Col19a1 APN 1 24561306 missense unknown
IGL00514:Col19a1 APN 1 24536932 missense unknown
IGL00756:Col19a1 APN 1 24322942 missense possibly damaging 0.85
IGL01408:Col19a1 APN 1 24306250 splice site probably benign
IGL01608:Col19a1 APN 1 24282545 missense probably damaging 1.00
IGL01664:Col19a1 APN 1 24561335 missense unknown
IGL01906:Col19a1 APN 1 24317429 missense probably damaging 1.00
IGL01916:Col19a1 APN 1 24534241 missense unknown
IGL02040:Col19a1 APN 1 24312045 critical splice donor site probably null
IGL02407:Col19a1 APN 1 24312372 splice site probably null
IGL02505:Col19a1 APN 1 24300584 splice site probably benign
IGL02606:Col19a1 APN 1 24534116 nonsense probably null
IGL02659:Col19a1 APN 1 24534034 missense unknown
IGL02815:Col19a1 APN 1 24285251 splice site probably null
IGL02880:Col19a1 APN 1 24325973 splice site probably benign
IGL02897:Col19a1 APN 1 24534098 missense unknown
IGL03102:Col19a1 APN 1 24328053 missense probably damaging 1.00
R0038:Col19a1 UTSW 1 24559744 missense unknown
R0109:Col19a1 UTSW 1 24559768 splice site probably null
R0124:Col19a1 UTSW 1 24526458 missense unknown
R0326:Col19a1 UTSW 1 24285051 critical splice donor site probably null
R0390:Col19a1 UTSW 1 24289655 splice site probably benign
R0675:Col19a1 UTSW 1 24575455 start gained probably benign
R0826:Col19a1 UTSW 1 24526386 missense unknown
R0948:Col19a1 UTSW 1 24296801 missense probably damaging 0.98
R1014:Col19a1 UTSW 1 24301273 critical splice donor site probably null
R1619:Col19a1 UTSW 1 24534091 missense unknown
R1691:Col19a1 UTSW 1 24536941 missense unknown
R1878:Col19a1 UTSW 1 24317395 missense probably benign 0.40
R1901:Col19a1 UTSW 1 24536997 missense unknown
R1928:Col19a1 UTSW 1 24451754 splice site probably benign
R1940:Col19a1 UTSW 1 24264750 nonsense probably null
R2015:Col19a1 UTSW 1 24559753 missense unknown
R2571:Col19a1 UTSW 1 24374631 missense unknown
R2844:Col19a1 UTSW 1 24559681 missense unknown
R2845:Col19a1 UTSW 1 24559681 missense unknown
R3107:Col19a1 UTSW 1 24337936 missense possibly damaging 0.71
R3861:Col19a1 UTSW 1 24326017 missense probably damaging 1.00
R3872:Col19a1 UTSW 1 24575327 splice site probably benign
R4180:Col19a1 UTSW 1 24270392 missense probably damaging 1.00
R4195:Col19a1 UTSW 1 24534052 missense unknown
R4196:Col19a1 UTSW 1 24534052 missense unknown
R4234:Col19a1 UTSW 1 24315395 splice site probably null
R4250:Col19a1 UTSW 1 24525645 missense unknown
R4396:Col19a1 UTSW 1 24510866 missense unknown
R4405:Col19a1 UTSW 1 24534109 missense unknown
R4450:Col19a1 UTSW 1 24322035 missense probably damaging 0.96
R4583:Col19a1 UTSW 1 24561329 missense unknown
R4980:Col19a1 UTSW 1 24526483 missense unknown
R5222:Col19a1 UTSW 1 24559640 splice site probably null
R5407:Col19a1 UTSW 1 24303494 missense probably damaging 0.99
R5439:Col19a1 UTSW 1 24293112 missense probably damaging 1.00
R5739:Col19a1 UTSW 1 24337915 missense probably damaging 1.00
R5740:Col19a1 UTSW 1 24337915 missense probably damaging 1.00
R5891:Col19a1 UTSW 1 24289725 missense probably damaging 1.00
R5996:Col19a1 UTSW 1 24328071 missense probably damaging 1.00
R6074:Col19a1 UTSW 1 24526483 missense unknown
R6152:Col19a1 UTSW 1 24374621 missense unknown
R6191:Col19a1 UTSW 1 24317393 missense probably damaging 1.00
R6236:Col19a1 UTSW 1 24279949 missense probably damaging 1.00
R6315:Col19a1 UTSW 1 24526452 missense unknown
R6709:Col19a1 UTSW 1 24282496 missense probably damaging 1.00
R6748:Col19a1 UTSW 1 24534070 missense unknown
R7098:Col19a1 UTSW 1 24526474 missense unknown
R7114:Col19a1 UTSW 1 24337936 missense possibly damaging 0.71
R7292:Col19a1 UTSW 1 24530008 missense unknown
R7392:Col19a1 UTSW 1 24534034 missense unknown
R7478:Col19a1 UTSW 1 24317707 missense probably damaging 1.00
R7480:Col19a1 UTSW 1 24317707 missense probably damaging 1.00
R7481:Col19a1 UTSW 1 24317707 missense probably damaging 1.00
R7512:Col19a1 UTSW 1 24317707 missense probably damaging 1.00
R7618:Col19a1 UTSW 1 24322084 missense probably benign 0.07
R7698:Col19a1 UTSW 1 24312078 missense probably benign 0.09
R7725:Col19a1 UTSW 1 24270444 missense possibly damaging 0.94
R7831:Col19a1 UTSW 1 24526482 missense unknown
R8252:Col19a1 UTSW 1 24279967 missense probably benign 0.05
Z1088:Col19a1 UTSW 1 24279940 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGAGATGCTTCACAAAGTCCTAC -3'
(R):5'- TTAGCCAAGCTTTGCCATTG -3'

Sequencing Primer
(F):5'- GATGCTTCACAAAGTCCTACACATAG -3'
(R):5'- CTGTAGCTGTTTCTCAAGTAATCC -3'
Posted On2019-11-12