Incidental Mutation 'R7711:Kif14'
ID594579
Institutional Source Beutler Lab
Gene Symbol Kif14
Ensembl Gene ENSMUSG00000041498
Gene Namekinesin family member 14
SynonymsN-3 kinesin, D1Ertd367e
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.878) question?
Stock #R7711 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location136466343-136531511 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 136471453 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Cysteine at position 451 (G451C)
Ref Sequence ENSEMBL: ENSMUSP00000139698 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047817] [ENSMUST00000189413] [ENSMUST00000195274] [ENSMUST00000201676]
PDB Structure
Crystal structure of the mouse Kif14 motor domain [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000047817
AA Change: G401C

PolyPhen 2 Score 0.097 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000044257
Gene: ENSMUSG00000041498
AA Change: G401C

DomainStartEndE-ValueType
KISc 341 694 1.45e-180 SMART
FHA 809 861 1.46e-7 SMART
coiled coil region 911 1060 N/A INTRINSIC
low complexity region 1169 1179 N/A INTRINSIC
low complexity region 1548 1559 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189413
AA Change: G451C

PolyPhen 2 Score 0.097 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000139698
Gene: ENSMUSG00000041498
AA Change: G451C

DomainStartEndE-ValueType
low complexity region 278 290 N/A INTRINSIC
KISc 391 744 1.45e-180 SMART
FHA 859 911 1.46e-7 SMART
coiled coil region 961 1110 N/A INTRINSIC
low complexity region 1219 1229 N/A INTRINSIC
low complexity region 1598 1609 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195274
SMART Domains Protein: ENSMUSP00000142040
Gene: ENSMUSG00000041498

DomainStartEndE-ValueType
Pfam:Kinesin 29 69 3.7e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000201676
AA Change: G451C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000144265
Gene: ENSMUSG00000041498
AA Change: G451C

DomainStartEndE-ValueType
low complexity region 278 290 N/A INTRINSIC
KISc 391 497 3.7e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kinesin-3 superfamily of microtubule motor proteins. These proteins are involved in numerous processes including vesicle transport, chromosome segregation, mitotic spindle formation, and cytokinesis. In human HeLa-S3 and 293T cells, this protein is localized to the cytoplasm during interphase, to the spindle poles and spindle microtubules during mitosis, and to the midbody during cytokinesis. An internal motor domain displays microtubule-dependent ATPase activity, consistent with its function as a microtubule motor protein. Knockdown of this gene results in failed cytokinesis with endoreplication, which results in multinucleated cells. This gene has been identified as a likely oncogene in breast, lung and ovarian cancers, as well as retinoblastomas and gliomas. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2015]
PHENOTYPE: Mice homozygous for a spontaneous mutation or targeted allele exhibit severe brain malformations, neurological defects and hypomyelination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik G A 8: 120,159,984 E342K possibly damaging Het
9430015G10Rik T G 4: 156,119,192 V34G probably damaging Het
Alkbh3 T C 2: 94,008,092 S44G probably benign Het
Alpk2 A T 18: 65,306,484 C613S probably benign Het
Aplp2 G A 9: 31,161,349 R488C probably damaging Het
Arid1b A G 17: 5,336,820 N1463S probably benign Het
Atxn2l A T 7: 126,501,269 L125Q probably damaging Het
C130060K24Rik A G 6: 65,441,373 H23R Het
Cd3d A G 9: 44,986,336 K172E probably benign Het
Chd7 T A 4: 8,805,234 D764E probably benign Het
Col19a1 T C 1: 24,530,008 I220V unknown Het
Cpq T C 15: 33,497,347 I411T probably benign Het
Crybg2 C A 4: 134,065,533 H160N probably benign Het
Cryl1 A T 14: 57,275,556 C285S probably benign Het
Dapk1 A G 13: 60,761,551 D1326G probably damaging Het
Dgkh A G 14: 78,725,019 V24A probably benign Het
Dnajb4 A C 3: 152,186,517 S226R probably benign Het
Dnm3 A T 1: 161,992,053 I850N possibly damaging Het
Dtna G T 18: 23,625,196 probably null Het
Efcab6 G T 15: 83,949,924 D494E probably benign Het
Fam169a G T 13: 97,126,688 E550* probably null Het
Fbxw7 A G 3: 84,925,681 N10S probably benign Het
Flrt2 T C 12: 95,780,754 F622S probably damaging Het
Gm17359 A G 3: 79,405,860 I80M probably damaging Het
Gm884 G T 11: 103,614,912 Q2077K probably benign Het
Gm906 T G 13: 50,247,095 R398S probably benign Het
Gprc5d G A 6: 135,116,357 T184I possibly damaging Het
Grem2 A G 1: 174,837,127 V52A probably damaging Het
Gtf3c2 G T 5: 31,170,189 T310N probably damaging Het
H2-Bl T A 17: 36,083,878 N51I probably damaging Het
Hyou1 A G 9: 44,384,462 D338G possibly damaging Het
Ifna6 T C 4: 88,827,734 S107P probably benign Het
Kit T A 5: 75,637,359 F436I probably damaging Het
Lonp2 G A 8: 86,714,008 C751Y probably damaging Het
Lonrf1 C A 8: 36,249,221 G87C probably damaging Het
Lrp2 T C 2: 69,479,343 probably null Het
Mkln1 A G 6: 31,492,649 H598R probably damaging Het
Mmaa T C 8: 79,268,145 H344R probably benign Het
Myh7 C G 14: 54,988,801 D461H probably damaging Het
Myh7b T G 2: 155,620,403 L342R probably damaging Het
Olfr1120 A G 2: 87,357,527 N28D probably benign Het
Olfr1291-ps1 T A 2: 111,500,152 I300K probably damaging Het
Olfr18 A T 9: 20,314,023 V299E possibly damaging Het
Olfr753-ps1 C T 17: 37,169,956 G129R probably damaging Het
Pcsk5 T A 19: 17,439,080 Y1668F possibly damaging Het
Pfn4 C T 12: 4,774,414 T47I possibly damaging Het
Pklr T C 3: 89,141,342 L104P probably damaging Het
Plcxd2 A G 16: 45,980,330 V177A probably benign Het
Pramef25 T C 4: 143,949,252 S335G probably benign Het
Prdm10 G T 9: 31,357,232 A826S probably damaging Het
Prrt4 A G 6: 29,177,456 S105P probably benign Het
Prss51 T A 14: 64,097,488 V164E probably damaging Het
Psap T C 10: 60,299,855 V360A probably damaging Het
Psg22 T C 7: 18,718,342 probably null Het
Rad51 A G 2: 119,131,590 Q206R probably benign Het
Rap1gds1 T C 3: 138,959,113 K277R probably benign Het
Rassf2 T A 2: 132,005,377 T103S probably benign Het
Rbm15b T A 9: 106,885,943 H342L possibly damaging Het
Rsf1 G GACCGCGGCC 7: 97,579,909 probably benign Het
Scaf8 T C 17: 3,187,634 F561L probably damaging Het
Scn1a G A 2: 66,303,660 A130V probably benign Het
Scn7a T C 2: 66,700,877 E552G probably damaging Het
Slc39a14 T A 14: 70,313,675 R183W probably damaging Het
Slfn1 A T 11: 83,121,263 K68N possibly damaging Het
Slx4ip A G 2: 137,067,994 D303G probably damaging Het
Snx17 T A 5: 31,195,460 F101Y probably damaging Het
Specc1l C A 10: 75,230,808 N30K probably benign Het
Tbx19 A G 1: 165,139,199 S369P probably benign Het
Usp17ld T C 7: 103,250,282 H481R probably damaging Het
Wnt2 A G 6: 17,990,037 L287P probably benign Het
Zfhx4 G T 3: 5,396,956 M1230I probably damaging Het
Zfp1 T C 8: 111,670,162 C272R not run Het
Zfp458 A G 13: 67,259,600 S64P possibly damaging Het
Other mutations in Kif14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Kif14 APN 1 136469018 missense probably benign 0.11
IGL00159:Kif14 APN 1 136469018 missense probably benign 0.11
IGL00160:Kif14 APN 1 136469018 missense probably benign 0.11
IGL00164:Kif14 APN 1 136469018 missense probably benign 0.11
IGL00310:Kif14 APN 1 136469018 missense probably benign 0.11
IGL00330:Kif14 APN 1 136469018 missense probably benign 0.11
IGL00335:Kif14 APN 1 136469018 missense probably benign 0.11
IGL00434:Kif14 APN 1 136469018 missense probably benign 0.11
IGL00468:Kif14 APN 1 136469018 missense probably benign 0.11
IGL01330:Kif14 APN 1 136476374 missense probably damaging 0.99
IGL01530:Kif14 APN 1 136478419 splice site probably benign
IGL01622:Kif14 APN 1 136497356 splice site probably benign
IGL01689:Kif14 APN 1 136519642 missense probably damaging 0.99
IGL02115:Kif14 APN 1 136496567 splice site probably benign
IGL02252:Kif14 APN 1 136478392 missense probably damaging 1.00
IGL02259:Kif14 APN 1 136500102 missense probably benign
IGL02439:Kif14 APN 1 136490261 missense probably damaging 1.00
IGL02590:Kif14 APN 1 136496004 missense probably benign 0.00
IGL02606:Kif14 APN 1 136496593 missense probably damaging 1.00
IGL03253:Kif14 APN 1 136487460 missense probably damaging 0.97
R0106:Kif14 UTSW 1 136479924 splice site probably benign
R0193:Kif14 UTSW 1 136468438 missense probably benign 0.00
R0238:Kif14 UTSW 1 136527393 missense probably damaging 0.99
R0238:Kif14 UTSW 1 136527393 missense probably damaging 0.99
R0239:Kif14 UTSW 1 136527393 missense probably damaging 0.99
R0239:Kif14 UTSW 1 136527393 missense probably damaging 0.99
R0329:Kif14 UTSW 1 136496026 splice site probably benign
R0346:Kif14 UTSW 1 136468160 missense probably damaging 1.00
R0393:Kif14 UTSW 1 136482418 missense probably damaging 1.00
R0519:Kif14 UTSW 1 136469147 missense probably damaging 1.00
R0590:Kif14 UTSW 1 136482472 missense probably damaging 0.97
R0633:Kif14 UTSW 1 136527305 missense probably damaging 0.96
R0657:Kif14 UTSW 1 136469102 missense probably benign 0.07
R0831:Kif14 UTSW 1 136525871 splice site probably benign
R0971:Kif14 UTSW 1 136519654 missense probably damaging 0.98
R1018:Kif14 UTSW 1 136495841 splice site probably benign
R1520:Kif14 UTSW 1 136503324 missense probably benign 0.00
R1713:Kif14 UTSW 1 136527464 missense probably benign 0.00
R1728:Kif14 UTSW 1 136468279 missense probably benign
R1728:Kif14 UTSW 1 136468975 missense probably damaging 1.00
R1728:Kif14 UTSW 1 136478365 missense probably benign 0.00
R1728:Kif14 UTSW 1 136490332 missense probably benign
R1728:Kif14 UTSW 1 136503431 missense probably benign 0.10
R1728:Kif14 UTSW 1 136515961 missense probably benign 0.04
R1728:Kif14 UTSW 1 136525783 missense probably benign 0.03
R1729:Kif14 UTSW 1 136468279 missense probably benign
R1729:Kif14 UTSW 1 136468975 missense probably damaging 1.00
R1729:Kif14 UTSW 1 136478365 missense probably benign 0.00
R1729:Kif14 UTSW 1 136490332 missense probably benign
R1729:Kif14 UTSW 1 136503431 missense probably benign 0.10
R1729:Kif14 UTSW 1 136515961 missense probably benign 0.04
R1729:Kif14 UTSW 1 136525783 missense probably benign 0.03
R1730:Kif14 UTSW 1 136468279 missense probably benign
R1730:Kif14 UTSW 1 136468975 missense probably damaging 1.00
R1730:Kif14 UTSW 1 136478365 missense probably benign 0.00
R1730:Kif14 UTSW 1 136490332 missense probably benign
R1730:Kif14 UTSW 1 136503431 missense probably benign 0.10
R1730:Kif14 UTSW 1 136515961 missense probably benign 0.04
R1730:Kif14 UTSW 1 136525783 missense probably benign 0.03
R1739:Kif14 UTSW 1 136468279 missense probably benign
R1739:Kif14 UTSW 1 136468975 missense probably damaging 1.00
R1739:Kif14 UTSW 1 136478365 missense probably benign 0.00
R1739:Kif14 UTSW 1 136490332 missense probably benign
R1739:Kif14 UTSW 1 136503431 missense probably benign 0.10
R1739:Kif14 UTSW 1 136515961 missense probably benign 0.04
R1739:Kif14 UTSW 1 136525783 missense probably benign 0.03
R1762:Kif14 UTSW 1 136468279 missense probably benign
R1762:Kif14 UTSW 1 136468975 missense probably damaging 1.00
R1762:Kif14 UTSW 1 136478365 missense probably benign 0.00
R1762:Kif14 UTSW 1 136490332 missense probably benign
R1762:Kif14 UTSW 1 136503431 missense probably benign 0.10
R1762:Kif14 UTSW 1 136515961 missense probably benign 0.04
R1762:Kif14 UTSW 1 136525783 missense probably benign 0.03
R1783:Kif14 UTSW 1 136468279 missense probably benign
R1783:Kif14 UTSW 1 136468975 missense probably damaging 1.00
R1783:Kif14 UTSW 1 136478365 missense probably benign 0.00
R1783:Kif14 UTSW 1 136490332 missense probably benign
R1783:Kif14 UTSW 1 136503431 missense probably benign 0.10
R1783:Kif14 UTSW 1 136515961 missense probably benign 0.04
R1783:Kif14 UTSW 1 136525783 missense probably benign 0.03
R1784:Kif14 UTSW 1 136468279 missense probably benign
R1784:Kif14 UTSW 1 136468975 missense probably damaging 1.00
R1784:Kif14 UTSW 1 136478365 missense probably benign 0.00
R1784:Kif14 UTSW 1 136490332 missense probably benign
R1784:Kif14 UTSW 1 136503431 missense probably benign 0.10
R1784:Kif14 UTSW 1 136515961 missense probably benign 0.04
R1784:Kif14 UTSW 1 136525783 missense probably benign 0.03
R1785:Kif14 UTSW 1 136468279 missense probably benign
R1785:Kif14 UTSW 1 136468975 missense probably damaging 1.00
R1785:Kif14 UTSW 1 136478365 missense probably benign 0.00
R1785:Kif14 UTSW 1 136490332 missense probably benign
R1785:Kif14 UTSW 1 136503431 missense probably benign 0.10
R1785:Kif14 UTSW 1 136515961 missense probably benign 0.04
R1785:Kif14 UTSW 1 136525783 missense probably benign 0.03
R1872:Kif14 UTSW 1 136486358 missense probably damaging 1.00
R2049:Kif14 UTSW 1 136487080 missense probably benign
R2049:Kif14 UTSW 1 136510167 missense possibly damaging 0.68
R2268:Kif14 UTSW 1 136519748 nonsense probably null
R2373:Kif14 UTSW 1 136479845 missense probably damaging 1.00
R3076:Kif14 UTSW 1 136519645 missense possibly damaging 0.51
R3077:Kif14 UTSW 1 136519645 missense possibly damaging 0.51
R3078:Kif14 UTSW 1 136519645 missense possibly damaging 0.51
R4232:Kif14 UTSW 1 136516363 nonsense probably null
R4246:Kif14 UTSW 1 136473388 missense possibly damaging 0.80
R4247:Kif14 UTSW 1 136473388 missense possibly damaging 0.80
R4250:Kif14 UTSW 1 136473388 missense possibly damaging 0.80
R4672:Kif14 UTSW 1 136521278 missense probably benign 0.00
R4672:Kif14 UTSW 1 136521279 missense probably benign
R4890:Kif14 UTSW 1 136487130 missense possibly damaging 0.91
R4994:Kif14 UTSW 1 136482959 missense probably damaging 1.00
R5102:Kif14 UTSW 1 136516403 missense probably benign 0.00
R5185:Kif14 UTSW 1 136527469 nonsense probably null
R5201:Kif14 UTSW 1 136503407 missense probably benign 0.00
R5399:Kif14 UTSW 1 136503324 missense probably benign 0.00
R5431:Kif14 UTSW 1 136496695 missense possibly damaging 0.91
R5932:Kif14 UTSW 1 136516390 missense probably benign 0.23
R6027:Kif14 UTSW 1 136483059 intron probably null
R6246:Kif14 UTSW 1 136476424 nonsense probably null
R6331:Kif14 UTSW 1 136515986 missense probably null 1.00
R6448:Kif14 UTSW 1 136503347 missense probably damaging 0.99
R6453:Kif14 UTSW 1 136482304 intron probably null
R6475:Kif14 UTSW 1 136527411 missense probably damaging 1.00
R6631:Kif14 UTSW 1 136515959 missense probably benign 0.39
R6713:Kif14 UTSW 1 136525806 missense probably benign
R7173:Kif14 UTSW 1 136479170 missense probably damaging 0.98
R7174:Kif14 UTSW 1 136521257 missense possibly damaging 0.67
R7241:Kif14 UTSW 1 136468753 missense probably benign 0.41
R7674:Kif14 UTSW 1 136468820 missense probably damaging 0.99
R7688:Kif14 UTSW 1 136494654 missense probably damaging 1.00
R7722:Kif14 UTSW 1 136468295 missense probably benign 0.00
R7763:Kif14 UTSW 1 136516383 missense probably benign 0.00
X0021:Kif14 UTSW 1 136490276 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGGGCCTTGACTTTTCTC -3'
(R):5'- GTGGTATTCTTTCTACAACCATGAG -3'

Sequencing Primer
(F):5'- CTCGCTGCTTCTTTTCATAGAGAG -3'
(R):5'- TTCTGACGAAAGAAAACATAAACGTG -3'
Posted On2019-11-12