Incidental Mutation 'R7711:Alkbh3'
ID594587
Institutional Source Beutler Lab
Gene Symbol Alkbh3
Ensembl Gene ENSMUSG00000040174
Gene NamealkB homolog 3, alpha-ketoglutarate-dependent dioxygenase
SynonymsmABH3, 1700108H04Rik, 1810020C19Rik, Abh3
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.190) question?
Stock #R7711 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location93980550-94010807 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 94008092 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 44 (S44G)
Ref Sequence ENSEMBL: ENSMUSP00000038721 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040005] [ENSMUST00000111240] [ENSMUST00000126378]
Predicted Effect probably benign
Transcript: ENSMUST00000040005
AA Change: S44G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000038721
Gene: ENSMUSG00000040174
AA Change: S44G

DomainStartEndE-ValueType
Pfam:2OG-FeII_Oxy_2 89 275 2e-34 PFAM
Pfam:2OG-FeII_Oxy 172 277 2.1e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111240
AA Change: S45G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000106871
Gene: ENSMUSG00000040174
AA Change: S45G

DomainStartEndE-ValueType
Pfam:2OG-FeII_Oxy_2 90 276 3.6e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126378
AA Change: S45G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000122043
Gene: ENSMUSG00000040174
AA Change: S45G

DomainStartEndE-ValueType
Pfam:2OG-FeII_Oxy_2 90 202 8.9e-14 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Escherichia coli AlkB protein protects against the cytotoxicity of methylating agents by repair of the specific DNA lesions generated in single-stranded DNA. ALKBH2 (MIM 610602) and ALKBH3 are E. coli AlkB homologs that catalyze the removal of 1-methyladenine and 3-methylcytosine (Duncan et al., 2002 [PubMed 12486230]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a normal lifespan and are phenotypically indistinguishable from control littermates. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik G A 8: 120,159,984 E342K possibly damaging Het
9430015G10Rik T G 4: 156,119,192 V34G probably damaging Het
Alpk2 A T 18: 65,306,484 C613S probably benign Het
Aplp2 G A 9: 31,161,349 R488C probably damaging Het
Arid1b A G 17: 5,336,820 N1463S probably benign Het
Atxn2l A T 7: 126,501,269 L125Q probably damaging Het
C130060K24Rik A G 6: 65,441,373 H23R Het
Cd3d A G 9: 44,986,336 K172E probably benign Het
Chd7 T A 4: 8,805,234 D764E probably benign Het
Col19a1 T C 1: 24,530,008 I220V unknown Het
Cpq T C 15: 33,497,347 I411T probably benign Het
Crybg2 C A 4: 134,065,533 H160N probably benign Het
Cryl1 A T 14: 57,275,556 C285S probably benign Het
Dapk1 A G 13: 60,761,551 D1326G probably damaging Het
Dgkh A G 14: 78,725,019 V24A probably benign Het
Dnajb4 A C 3: 152,186,517 S226R probably benign Het
Dnm3 A T 1: 161,992,053 I850N possibly damaging Het
Dtna G T 18: 23,625,196 probably null Het
Efcab6 G T 15: 83,949,924 D494E probably benign Het
Fam169a G T 13: 97,126,688 E550* probably null Het
Fbxw7 A G 3: 84,925,681 N10S probably benign Het
Flrt2 T C 12: 95,780,754 F622S probably damaging Het
Gm17359 A G 3: 79,405,860 I80M probably damaging Het
Gm884 G T 11: 103,614,912 Q2077K probably benign Het
Gm906 T G 13: 50,247,095 R398S probably benign Het
Gprc5d G A 6: 135,116,357 T184I possibly damaging Het
Grem2 A G 1: 174,837,127 V52A probably damaging Het
Gtf3c2 G T 5: 31,170,189 T310N probably damaging Het
H2-Bl T A 17: 36,083,878 N51I probably damaging Het
Hyou1 A G 9: 44,384,462 D338G possibly damaging Het
Ifna6 T C 4: 88,827,734 S107P probably benign Het
Kif14 G T 1: 136,471,453 G451C probably benign Het
Kit T A 5: 75,637,359 F436I probably damaging Het
Lonp2 G A 8: 86,714,008 C751Y probably damaging Het
Lonrf1 C A 8: 36,249,221 G87C probably damaging Het
Lrp2 T C 2: 69,479,343 probably null Het
Mkln1 A G 6: 31,492,649 H598R probably damaging Het
Mmaa T C 8: 79,268,145 H344R probably benign Het
Myh7 C G 14: 54,988,801 D461H probably damaging Het
Myh7b T G 2: 155,620,403 L342R probably damaging Het
Olfr1120 A G 2: 87,357,527 N28D probably benign Het
Olfr1291-ps1 T A 2: 111,500,152 I300K probably damaging Het
Olfr18 A T 9: 20,314,023 V299E possibly damaging Het
Olfr753-ps1 C T 17: 37,169,956 G129R probably damaging Het
Pcsk5 T A 19: 17,439,080 Y1668F possibly damaging Het
Pfn4 C T 12: 4,774,414 T47I possibly damaging Het
Pklr T C 3: 89,141,342 L104P probably damaging Het
Plcxd2 A G 16: 45,980,330 V177A probably benign Het
Pramef25 T C 4: 143,949,252 S335G probably benign Het
Prdm10 G T 9: 31,357,232 A826S probably damaging Het
Prrt4 A G 6: 29,177,456 S105P probably benign Het
Prss51 T A 14: 64,097,488 V164E probably damaging Het
Psap T C 10: 60,299,855 V360A probably damaging Het
Psg22 T C 7: 18,718,342 probably null Het
Rad51 A G 2: 119,131,590 Q206R probably benign Het
Rap1gds1 T C 3: 138,959,113 K277R probably benign Het
Rassf2 T A 2: 132,005,377 T103S probably benign Het
Rbm15b T A 9: 106,885,943 H342L possibly damaging Het
Rsf1 G GACCGCGGCC 7: 97,579,909 probably benign Het
Scaf8 T C 17: 3,187,634 F561L probably damaging Het
Scn1a G A 2: 66,303,660 A130V probably benign Het
Scn7a T C 2: 66,700,877 E552G probably damaging Het
Slc39a14 T A 14: 70,313,675 R183W probably damaging Het
Slfn1 A T 11: 83,121,263 K68N possibly damaging Het
Slx4ip A G 2: 137,067,994 D303G probably damaging Het
Snx17 T A 5: 31,195,460 F101Y probably damaging Het
Specc1l C A 10: 75,230,808 N30K probably benign Het
Tbx19 A G 1: 165,139,199 S369P probably benign Het
Usp17ld T C 7: 103,250,282 H481R probably damaging Het
Wnt2 A G 6: 17,990,037 L287P probably benign Het
Zfhx4 G T 3: 5,396,956 M1230I probably damaging Het
Zfp1 T C 8: 111,670,162 C272R not run Het
Zfp458 A G 13: 67,259,600 S64P possibly damaging Het
Other mutations in Alkbh3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01363:Alkbh3 APN 2 94003051 critical splice donor site probably null
IGL01940:Alkbh3 APN 2 93981595 missense probably damaging 0.98
IGL02554:Alkbh3 APN 2 93996347 missense probably damaging 1.00
IGL02638:Alkbh3 APN 2 94008113 missense probably benign 0.02
IGL02640:Alkbh3 APN 2 93996361 missense possibly damaging 0.90
R0409:Alkbh3 UTSW 2 94001448 missense possibly damaging 0.84
R0437:Alkbh3 UTSW 2 93981569 missense probably damaging 1.00
R1456:Alkbh3 UTSW 2 94001419 splice site probably null
R1592:Alkbh3 UTSW 2 94008424 intron probably null
R2359:Alkbh3 UTSW 2 94008113 missense probably benign 0.01
R3109:Alkbh3 UTSW 2 94004763 missense probably damaging 1.00
R4297:Alkbh3 UTSW 2 94008124 missense probably benign
R5562:Alkbh3 UTSW 2 93996379 unclassified probably null
R6216:Alkbh3 UTSW 2 94008536 start gained probably benign
R7088:Alkbh3 UTSW 2 94004752 missense possibly damaging 0.55
R8014:Alkbh3 UTSW 2 94001513 missense probably benign
Predicted Primers PCR Primer
(F):5'- AATCCTTTGTTCTGCTACTCACAAG -3'
(R):5'- ATGTGACTGCCATTTTGTCTGC -3'

Sequencing Primer
(F):5'- GCTACTCACAAGTAAATGTATTCAGC -3'
(R):5'- AACTAAGGGTATGAACGTGGTTTCTC -3'
Posted On2019-11-12