Incidental Mutation 'R7711:Myh7b'
ID 594592
Institutional Source Beutler Lab
Gene Symbol Myh7b
Ensembl Gene ENSMUSG00000074652
Gene Name myosin, heavy chain 7B, cardiac muscle, beta
Synonyms Myh14
MMRRC Submission 045769-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7711 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 155453132-155476227 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 155462323 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Arginine at position 342 (L342R)
Ref Sequence ENSEMBL: ENSMUSP00000090672 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092995]
AlphaFold A2AQP0
Predicted Effect probably damaging
Transcript: ENSMUST00000092995
AA Change: L342R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000090672
Gene: ENSMUSG00000074652
AA Change: L342R

DomainStartEndE-ValueType
Pfam:Myosin_N 32 72 4.7e-14 PFAM
MYSc 78 786 N/A SMART
IQ 787 809 2.6e0 SMART
Pfam:Myosin_tail_1 850 1931 5.5e-149 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a myosin heavy chain. The encoded protein forms a hexamer comprised of two heavy chains, two alkali light chains, and two regulatory light chain components. This complex functions in muscle contraction. [provided by RefSeq, Jun 2013]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik G A 8: 120,886,723 (GRCm39) E342K possibly damaging Het
9430015G10Rik T G 4: 156,203,649 (GRCm39) V34G probably damaging Het
Alkbh3 T C 2: 93,838,437 (GRCm39) S44G probably benign Het
Alpk2 A T 18: 65,439,555 (GRCm39) C613S probably benign Het
Aplp2 G A 9: 31,072,645 (GRCm39) R488C probably damaging Het
Arid1b A G 17: 5,387,095 (GRCm39) N1463S probably benign Het
Atxn2l A T 7: 126,100,441 (GRCm39) L125Q probably damaging Het
Cd3d A G 9: 44,897,634 (GRCm39) K172E probably benign Het
Chd7 T A 4: 8,805,234 (GRCm39) D764E probably benign Het
Col19a1 T C 1: 24,569,089 (GRCm39) I220V unknown Het
Cpq T C 15: 33,497,493 (GRCm39) I411T probably benign Het
Crybg2 C A 4: 133,792,844 (GRCm39) H160N probably benign Het
Cryl1 A T 14: 57,513,013 (GRCm39) C285S probably benign Het
Dapk1 A G 13: 60,909,365 (GRCm39) D1326G probably damaging Het
Dgkh A G 14: 78,962,459 (GRCm39) V24A probably benign Het
Dnajb4 A C 3: 151,892,154 (GRCm39) S226R probably benign Het
Dnm3 A T 1: 161,819,622 (GRCm39) I850N possibly damaging Het
Dtna G T 18: 23,758,253 (GRCm39) probably null Het
Efcab6 G T 15: 83,834,125 (GRCm39) D494E probably benign Het
Fam169a G T 13: 97,263,196 (GRCm39) E550* probably null Het
Fbxw7 A G 3: 84,832,988 (GRCm39) N10S probably benign Het
Flrt2 T C 12: 95,747,528 (GRCm39) F622S probably damaging Het
Gprc5d G A 6: 135,093,355 (GRCm39) T184I possibly damaging Het
Grem2 A G 1: 174,664,693 (GRCm39) V52A probably damaging Het
Gtf3c2 G T 5: 31,327,533 (GRCm39) T310N probably damaging Het
H2-T13 T A 17: 36,394,770 (GRCm39) N51I probably damaging Het
Hyou1 A G 9: 44,295,759 (GRCm39) D338G possibly damaging Het
Ifna6 T C 4: 88,745,971 (GRCm39) S107P probably benign Het
Kif14 G T 1: 136,399,191 (GRCm39) G451C probably benign Het
Kit T A 5: 75,798,019 (GRCm39) F436I probably damaging Het
Lonp2 G A 8: 87,440,636 (GRCm39) C751Y probably damaging Het
Lonrf1 C A 8: 36,716,375 (GRCm39) G87C probably damaging Het
Lrp2 T C 2: 69,309,687 (GRCm39) probably null Het
Lrrc37 G T 11: 103,505,738 (GRCm39) Q2077K probably benign Het
Mkln1 A G 6: 31,469,584 (GRCm39) H598R probably damaging Het
Mmaa T C 8: 79,994,774 (GRCm39) H344R probably benign Het
Myh7 C G 14: 55,226,258 (GRCm39) D461H probably damaging Het
Or12e8 A G 2: 87,187,871 (GRCm39) N28D probably benign Het
Or2h2b-ps1 C T 17: 37,480,847 (GRCm39) G129R probably damaging Het
Or4f4-ps1 T A 2: 111,330,497 (GRCm39) I300K probably damaging Het
Or7e178 A T 9: 20,225,319 (GRCm39) V299E possibly damaging Het
Pcsk5 T A 19: 17,416,444 (GRCm39) Y1668F possibly damaging Het
Pfn4 C T 12: 4,824,414 (GRCm39) T47I possibly damaging Het
Pklr T C 3: 89,048,649 (GRCm39) L104P probably damaging Het
Plcxd2 A G 16: 45,800,693 (GRCm39) V177A probably benign Het
Pramel16 T C 4: 143,675,822 (GRCm39) S335G probably benign Het
Prdm10 G T 9: 31,268,528 (GRCm39) A826S probably damaging Het
Prrt4 A G 6: 29,177,455 (GRCm39) S105P probably benign Het
Prss51 T A 14: 64,334,937 (GRCm39) V164E probably damaging Het
Psap T C 10: 60,135,634 (GRCm39) V360A probably damaging Het
Psg22 T C 7: 18,452,267 (GRCm39) probably null Het
Qrfprl A G 6: 65,418,357 (GRCm39) H23R Het
Rad51 A G 2: 118,962,071 (GRCm39) Q206R probably benign Het
Rap1gds1 T C 3: 138,664,874 (GRCm39) K277R probably benign Het
Rassf2 T A 2: 131,847,297 (GRCm39) T103S probably benign Het
Rbm15b T A 9: 106,763,142 (GRCm39) H342L possibly damaging Het
Rsf1 G GACCGCGGCC 7: 97,229,116 (GRCm39) probably benign Het
Scaf8 T C 17: 3,237,909 (GRCm39) F561L probably damaging Het
Scn1a G A 2: 66,134,004 (GRCm39) A130V probably benign Het
Scn7a T C 2: 66,531,221 (GRCm39) E552G probably damaging Het
Slc39a14 T A 14: 70,551,124 (GRCm39) R183W probably damaging Het
Slfn1 A T 11: 83,012,089 (GRCm39) K68N possibly damaging Het
Slx4ip A G 2: 136,909,914 (GRCm39) D303G probably damaging Het
Snx17 T A 5: 31,352,804 (GRCm39) F101Y probably damaging Het
Spata31e3 T G 13: 50,401,131 (GRCm39) R398S probably benign Het
Specc1l C A 10: 75,066,642 (GRCm39) N30K probably benign Het
Spmip2 A G 3: 79,313,167 (GRCm39) I80M probably damaging Het
Tbx19 A G 1: 164,966,768 (GRCm39) S369P probably benign Het
Usp17ld T C 7: 102,899,489 (GRCm39) H481R probably damaging Het
Wnt2 A G 6: 17,990,036 (GRCm39) L287P probably benign Het
Zfhx4 G T 3: 5,462,016 (GRCm39) M1230I probably damaging Het
Zfp1 T C 8: 112,396,794 (GRCm39) C272R not run Het
Zfp458 A G 13: 67,407,664 (GRCm39) S64P possibly damaging Het
Other mutations in Myh7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00931:Myh7b APN 2 155,472,212 (GRCm39) missense probably damaging 0.99
IGL01604:Myh7b APN 2 155,474,327 (GRCm39) missense probably damaging 0.96
IGL02179:Myh7b APN 2 155,456,411 (GRCm39) missense probably benign 0.02
IGL02729:Myh7b APN 2 155,467,609 (GRCm39) missense probably damaging 1.00
IGL02804:Myh7b APN 2 155,467,643 (GRCm39) missense probably damaging 1.00
IGL02851:Myh7b APN 2 155,470,747 (GRCm39) missense probably damaging 1.00
IGL02956:Myh7b APN 2 155,467,874 (GRCm39) missense possibly damaging 0.95
IGL02956:Myh7b APN 2 155,474,823 (GRCm39) missense probably damaging 1.00
IGL02992:Myh7b APN 2 155,463,330 (GRCm39) missense probably damaging 0.99
IGL03060:Myh7b APN 2 155,474,671 (GRCm39) missense probably damaging 1.00
IGL03061:Myh7b APN 2 155,462,031 (GRCm39) missense possibly damaging 0.93
IGL03226:Myh7b APN 2 155,462,403 (GRCm39) nonsense probably null
IGL03246:Myh7b APN 2 155,459,792 (GRCm39) missense probably damaging 1.00
IGL03382:Myh7b APN 2 155,465,399 (GRCm39) missense probably damaging 1.00
euclidian UTSW 2 155,475,319 (GRCm39) missense probably benign 0.32
imaginary UTSW 2 155,474,175 (GRCm39) missense probably benign 0.36
Irrational UTSW 2 155,472,592 (GRCm39) unclassified probably benign
Muscoli UTSW 2 155,462,038 (GRCm39) nonsense probably null
R0015:Myh7b UTSW 2 155,464,206 (GRCm39) missense probably damaging 1.00
R0015:Myh7b UTSW 2 155,464,206 (GRCm39) missense probably damaging 1.00
R0109:Myh7b UTSW 2 155,453,594 (GRCm39) missense possibly damaging 0.92
R0309:Myh7b UTSW 2 155,472,592 (GRCm39) unclassified probably benign
R0567:Myh7b UTSW 2 155,468,318 (GRCm39) missense probably damaging 1.00
R0619:Myh7b UTSW 2 155,453,642 (GRCm39) missense probably benign 0.00
R0927:Myh7b UTSW 2 155,462,040 (GRCm39) missense probably damaging 1.00
R0973:Myh7b UTSW 2 155,462,347 (GRCm39) missense probably benign
R0973:Myh7b UTSW 2 155,462,347 (GRCm39) missense probably benign
R0974:Myh7b UTSW 2 155,462,347 (GRCm39) missense probably benign
R1137:Myh7b UTSW 2 155,464,634 (GRCm39) missense probably damaging 1.00
R1261:Myh7b UTSW 2 155,463,003 (GRCm39) missense probably benign 0.00
R1268:Myh7b UTSW 2 155,455,966 (GRCm39) nonsense probably null
R1537:Myh7b UTSW 2 155,473,707 (GRCm39) missense probably damaging 0.96
R1632:Myh7b UTSW 2 155,462,445 (GRCm39) missense probably benign 0.04
R1694:Myh7b UTSW 2 155,455,113 (GRCm39) missense probably damaging 0.99
R1697:Myh7b UTSW 2 155,462,054 (GRCm39) missense probably damaging 1.00
R1730:Myh7b UTSW 2 155,467,592 (GRCm39) missense possibly damaging 0.73
R1762:Myh7b UTSW 2 155,472,778 (GRCm39) missense probably damaging 0.96
R1783:Myh7b UTSW 2 155,467,592 (GRCm39) missense possibly damaging 0.73
R2105:Myh7b UTSW 2 155,471,377 (GRCm39) missense probably benign 0.00
R2140:Myh7b UTSW 2 155,462,043 (GRCm39) missense probably damaging 1.00
R2971:Myh7b UTSW 2 155,474,175 (GRCm39) missense probably benign 0.36
R3838:Myh7b UTSW 2 155,474,909 (GRCm39) missense probably damaging 1.00
R4074:Myh7b UTSW 2 155,460,678 (GRCm39) missense probably damaging 0.96
R4191:Myh7b UTSW 2 155,475,319 (GRCm39) missense probably benign 0.32
R4689:Myh7b UTSW 2 155,472,434 (GRCm39) missense possibly damaging 0.75
R4695:Myh7b UTSW 2 155,456,097 (GRCm39) missense probably damaging 1.00
R4697:Myh7b UTSW 2 155,471,242 (GRCm39) missense probably damaging 1.00
R4771:Myh7b UTSW 2 155,468,314 (GRCm39) nonsense probably null
R4794:Myh7b UTSW 2 155,465,186 (GRCm39) missense probably benign 0.00
R4842:Myh7b UTSW 2 155,475,909 (GRCm39) missense probably benign 0.45
R4871:Myh7b UTSW 2 155,455,420 (GRCm39) missense probably benign 0.18
R5022:Myh7b UTSW 2 155,474,293 (GRCm39) missense possibly damaging 0.75
R5023:Myh7b UTSW 2 155,474,293 (GRCm39) missense possibly damaging 0.75
R5025:Myh7b UTSW 2 155,474,293 (GRCm39) missense possibly damaging 0.75
R5050:Myh7b UTSW 2 155,473,670 (GRCm39) missense probably benign 0.00
R5055:Myh7b UTSW 2 155,474,293 (GRCm39) missense possibly damaging 0.75
R5056:Myh7b UTSW 2 155,474,293 (GRCm39) missense possibly damaging 0.75
R5161:Myh7b UTSW 2 155,474,293 (GRCm39) missense possibly damaging 0.75
R5284:Myh7b UTSW 2 155,474,234 (GRCm39) missense probably benign
R5422:Myh7b UTSW 2 155,472,954 (GRCm39) missense probably damaging 0.99
R5505:Myh7b UTSW 2 155,474,592 (GRCm39) missense probably benign 0.01
R5946:Myh7b UTSW 2 155,463,315 (GRCm39) missense probably damaging 1.00
R6089:Myh7b UTSW 2 155,464,409 (GRCm39) missense probably damaging 1.00
R6103:Myh7b UTSW 2 155,460,663 (GRCm39) missense probably damaging 1.00
R6233:Myh7b UTSW 2 155,473,719 (GRCm39) missense possibly damaging 0.85
R6292:Myh7b UTSW 2 155,474,316 (GRCm39) missense probably damaging 1.00
R6350:Myh7b UTSW 2 155,470,680 (GRCm39) missense probably benign 0.00
R6484:Myh7b UTSW 2 155,470,563 (GRCm39) missense probably benign 0.05
R6760:Myh7b UTSW 2 155,462,038 (GRCm39) nonsense probably null
R6896:Myh7b UTSW 2 155,464,488 (GRCm39) critical splice donor site probably null
R6945:Myh7b UTSW 2 155,464,152 (GRCm39) missense possibly damaging 0.95
R7020:Myh7b UTSW 2 155,473,671 (GRCm39) missense possibly damaging 0.56
R7052:Myh7b UTSW 2 155,456,053 (GRCm39) missense probably damaging 1.00
R7102:Myh7b UTSW 2 155,464,119 (GRCm39) missense probably damaging 1.00
R7248:Myh7b UTSW 2 155,464,106 (GRCm39) missense probably damaging 1.00
R7303:Myh7b UTSW 2 155,460,660 (GRCm39) missense probably damaging 1.00
R7360:Myh7b UTSW 2 155,474,460 (GRCm39) missense probably benign 0.38
R7652:Myh7b UTSW 2 155,474,156 (GRCm39) missense probably damaging 0.99
R7678:Myh7b UTSW 2 155,459,698 (GRCm39) splice site probably null
R7703:Myh7b UTSW 2 155,462,356 (GRCm39) missense probably null 1.00
R7923:Myh7b UTSW 2 155,467,886 (GRCm39) missense probably benign
R7967:Myh7b UTSW 2 155,456,119 (GRCm39) splice site probably null
R8045:Myh7b UTSW 2 155,455,101 (GRCm39) missense probably benign 0.00
R8176:Myh7b UTSW 2 155,467,886 (GRCm39) missense probably benign 0.06
R8272:Myh7b UTSW 2 155,474,824 (GRCm39) missense probably damaging 1.00
R8560:Myh7b UTSW 2 155,465,124 (GRCm39) missense possibly damaging 0.93
R8706:Myh7b UTSW 2 155,453,669 (GRCm39) critical splice donor site probably null
R8824:Myh7b UTSW 2 155,472,301 (GRCm39) missense probably benign 0.02
R8832:Myh7b UTSW 2 155,475,182 (GRCm39) missense probably benign 0.00
R9079:Myh7b UTSW 2 155,465,174 (GRCm39) missense probably damaging 0.97
R9151:Myh7b UTSW 2 155,474,439 (GRCm39) missense probably damaging 1.00
R9311:Myh7b UTSW 2 155,463,253 (GRCm39) missense probably damaging 1.00
R9332:Myh7b UTSW 2 155,470,722 (GRCm39) missense probably damaging 1.00
R9357:Myh7b UTSW 2 155,463,268 (GRCm39) missense probably damaging 1.00
R9388:Myh7b UTSW 2 155,472,983 (GRCm39) missense probably benign 0.28
R9583:Myh7b UTSW 2 155,459,641 (GRCm39) missense probably damaging 1.00
R9657:Myh7b UTSW 2 155,455,963 (GRCm39) missense probably damaging 1.00
R9738:Myh7b UTSW 2 155,455,963 (GRCm39) missense probably damaging 1.00
X0013:Myh7b UTSW 2 155,473,089 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGAGGAACTTATCGCCACTG -3'
(R):5'- AAGTTTCCAGGGTAAAGGCC -3'

Sequencing Primer
(F):5'- ATCGCCACTGATGTACGATG -3'
(R):5'- TTTCCAGGGTAAAGGCCAGGTC -3'
Posted On 2019-11-12