Incidental Mutation 'R7711:Myh7b'
ID594592
Institutional Source Beutler Lab
Gene Symbol Myh7b
Ensembl Gene ENSMUSG00000074652
Gene Namemyosin, heavy chain 7B, cardiac muscle, beta
SynonymsMyh14
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7711 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location155611212-155634307 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 155620403 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 342 (L342R)
Ref Sequence ENSEMBL: ENSMUSP00000090672 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092995]
Predicted Effect probably damaging
Transcript: ENSMUST00000092995
AA Change: L342R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000090672
Gene: ENSMUSG00000074652
AA Change: L342R

DomainStartEndE-ValueType
Pfam:Myosin_N 32 72 4.7e-14 PFAM
MYSc 78 786 N/A SMART
IQ 787 809 2.6e0 SMART
Pfam:Myosin_tail_1 850 1931 5.5e-149 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a myosin heavy chain. The encoded protein forms a hexamer comprised of two heavy chains, two alkali light chains, and two regulatory light chain components. This complex functions in muscle contraction. [provided by RefSeq, Jun 2013]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik G A 8: 120,159,984 E342K possibly damaging Het
9430015G10Rik T G 4: 156,119,192 V34G probably damaging Het
Alkbh3 T C 2: 94,008,092 S44G probably benign Het
Alpk2 A T 18: 65,306,484 C613S probably benign Het
Aplp2 G A 9: 31,161,349 R488C probably damaging Het
Arid1b A G 17: 5,336,820 N1463S probably benign Het
Atxn2l A T 7: 126,501,269 L125Q probably damaging Het
C130060K24Rik A G 6: 65,441,373 H23R Het
Cd3d A G 9: 44,986,336 K172E probably benign Het
Chd7 T A 4: 8,805,234 D764E probably benign Het
Col19a1 T C 1: 24,530,008 I220V unknown Het
Cpq T C 15: 33,497,347 I411T probably benign Het
Crybg2 C A 4: 134,065,533 H160N probably benign Het
Cryl1 A T 14: 57,275,556 C285S probably benign Het
Dapk1 A G 13: 60,761,551 D1326G probably damaging Het
Dgkh A G 14: 78,725,019 V24A probably benign Het
Dnajb4 A C 3: 152,186,517 S226R probably benign Het
Dnm3 A T 1: 161,992,053 I850N possibly damaging Het
Dtna G T 18: 23,625,196 probably null Het
Efcab6 G T 15: 83,949,924 D494E probably benign Het
Fam169a G T 13: 97,126,688 E550* probably null Het
Fbxw7 A G 3: 84,925,681 N10S probably benign Het
Flrt2 T C 12: 95,780,754 F622S probably damaging Het
Gm17359 A G 3: 79,405,860 I80M probably damaging Het
Gm884 G T 11: 103,614,912 Q2077K probably benign Het
Gm906 T G 13: 50,247,095 R398S probably benign Het
Gprc5d G A 6: 135,116,357 T184I possibly damaging Het
Grem2 A G 1: 174,837,127 V52A probably damaging Het
Gtf3c2 G T 5: 31,170,189 T310N probably damaging Het
H2-Bl T A 17: 36,083,878 N51I probably damaging Het
Hyou1 A G 9: 44,384,462 D338G possibly damaging Het
Ifna6 T C 4: 88,827,734 S107P probably benign Het
Kif14 G T 1: 136,471,453 G451C probably benign Het
Kit T A 5: 75,637,359 F436I probably damaging Het
Lonp2 G A 8: 86,714,008 C751Y probably damaging Het
Lonrf1 C A 8: 36,249,221 G87C probably damaging Het
Lrp2 T C 2: 69,479,343 probably null Het
Mkln1 A G 6: 31,492,649 H598R probably damaging Het
Mmaa T C 8: 79,268,145 H344R probably benign Het
Myh7 C G 14: 54,988,801 D461H probably damaging Het
Olfr1120 A G 2: 87,357,527 N28D probably benign Het
Olfr1291-ps1 T A 2: 111,500,152 I300K probably damaging Het
Olfr18 A T 9: 20,314,023 V299E possibly damaging Het
Olfr753-ps1 C T 17: 37,169,956 G129R probably damaging Het
Pcsk5 T A 19: 17,439,080 Y1668F possibly damaging Het
Pfn4 C T 12: 4,774,414 T47I possibly damaging Het
Pklr T C 3: 89,141,342 L104P probably damaging Het
Plcxd2 A G 16: 45,980,330 V177A probably benign Het
Pramef25 T C 4: 143,949,252 S335G probably benign Het
Prdm10 G T 9: 31,357,232 A826S probably damaging Het
Prrt4 A G 6: 29,177,456 S105P probably benign Het
Prss51 T A 14: 64,097,488 V164E probably damaging Het
Psap T C 10: 60,299,855 V360A probably damaging Het
Psg22 T C 7: 18,718,342 probably null Het
Rad51 A G 2: 119,131,590 Q206R probably benign Het
Rap1gds1 T C 3: 138,959,113 K277R probably benign Het
Rassf2 T A 2: 132,005,377 T103S probably benign Het
Rbm15b T A 9: 106,885,943 H342L possibly damaging Het
Rsf1 G GACCGCGGCC 7: 97,579,909 probably benign Het
Scaf8 T C 17: 3,187,634 F561L probably damaging Het
Scn1a G A 2: 66,303,660 A130V probably benign Het
Scn7a T C 2: 66,700,877 E552G probably damaging Het
Slc39a14 T A 14: 70,313,675 R183W probably damaging Het
Slfn1 A T 11: 83,121,263 K68N possibly damaging Het
Slx4ip A G 2: 137,067,994 D303G probably damaging Het
Snx17 T A 5: 31,195,460 F101Y probably damaging Het
Specc1l C A 10: 75,230,808 N30K probably benign Het
Tbx19 A G 1: 165,139,199 S369P probably benign Het
Usp17ld T C 7: 103,250,282 H481R probably damaging Het
Wnt2 A G 6: 17,990,037 L287P probably benign Het
Zfhx4 G T 3: 5,396,956 M1230I probably damaging Het
Zfp1 T C 8: 111,670,162 C272R not run Het
Zfp458 A G 13: 67,259,600 S64P possibly damaging Het
Other mutations in Myh7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00931:Myh7b APN 2 155630292 missense probably damaging 0.99
IGL01604:Myh7b APN 2 155632407 missense probably damaging 0.96
IGL02179:Myh7b APN 2 155614491 missense probably benign 0.02
IGL02729:Myh7b APN 2 155625689 missense probably damaging 1.00
IGL02804:Myh7b APN 2 155625723 missense probably damaging 1.00
IGL02851:Myh7b APN 2 155628827 missense probably damaging 1.00
IGL02956:Myh7b APN 2 155632903 missense probably damaging 1.00
IGL02956:Myh7b APN 2 155625954 missense possibly damaging 0.95
IGL02992:Myh7b APN 2 155621410 missense probably damaging 0.99
IGL03060:Myh7b APN 2 155632751 missense probably damaging 1.00
IGL03061:Myh7b APN 2 155620111 missense possibly damaging 0.93
IGL03226:Myh7b APN 2 155620483 nonsense probably null
IGL03246:Myh7b APN 2 155617872 missense probably damaging 1.00
IGL03382:Myh7b APN 2 155623479 missense probably damaging 1.00
euclidian UTSW 2 155633399 missense probably benign 0.32
imaginary UTSW 2 155632255 missense probably benign 0.36
Irrational UTSW 2 155630672 unclassified probably benign
Muscoli UTSW 2 155620118 nonsense probably null
R0015:Myh7b UTSW 2 155622286 missense probably damaging 1.00
R0015:Myh7b UTSW 2 155622286 missense probably damaging 1.00
R0109:Myh7b UTSW 2 155611674 missense possibly damaging 0.92
R0309:Myh7b UTSW 2 155630672 unclassified probably benign
R0567:Myh7b UTSW 2 155626398 missense probably damaging 1.00
R0619:Myh7b UTSW 2 155611722 missense probably benign 0.00
R0927:Myh7b UTSW 2 155620120 missense probably damaging 1.00
R0973:Myh7b UTSW 2 155620427 missense probably benign
R0973:Myh7b UTSW 2 155620427 missense probably benign
R0974:Myh7b UTSW 2 155620427 missense probably benign
R1137:Myh7b UTSW 2 155622714 missense probably damaging 1.00
R1261:Myh7b UTSW 2 155621083 missense probably benign 0.00
R1268:Myh7b UTSW 2 155614046 nonsense probably null
R1537:Myh7b UTSW 2 155631787 missense probably damaging 0.96
R1632:Myh7b UTSW 2 155620525 missense probably benign 0.04
R1694:Myh7b UTSW 2 155613193 missense probably damaging 0.99
R1697:Myh7b UTSW 2 155620134 missense probably damaging 1.00
R1730:Myh7b UTSW 2 155625672 missense possibly damaging 0.73
R1762:Myh7b UTSW 2 155630858 missense probably damaging 0.96
R1783:Myh7b UTSW 2 155625672 missense possibly damaging 0.73
R2105:Myh7b UTSW 2 155629457 missense probably benign 0.00
R2140:Myh7b UTSW 2 155620123 missense probably damaging 1.00
R2971:Myh7b UTSW 2 155632255 missense probably benign 0.36
R3838:Myh7b UTSW 2 155632989 missense probably damaging 1.00
R4074:Myh7b UTSW 2 155618758 missense probably damaging 0.96
R4191:Myh7b UTSW 2 155633399 missense probably benign 0.32
R4689:Myh7b UTSW 2 155630514 missense possibly damaging 0.75
R4695:Myh7b UTSW 2 155614177 missense probably damaging 1.00
R4697:Myh7b UTSW 2 155629322 missense probably damaging 1.00
R4771:Myh7b UTSW 2 155626394 nonsense probably null
R4794:Myh7b UTSW 2 155623266 missense probably benign 0.00
R4842:Myh7b UTSW 2 155633989 missense probably benign 0.45
R4871:Myh7b UTSW 2 155613500 missense probably benign 0.18
R5022:Myh7b UTSW 2 155632373 missense possibly damaging 0.75
R5023:Myh7b UTSW 2 155632373 missense possibly damaging 0.75
R5025:Myh7b UTSW 2 155632373 missense possibly damaging 0.75
R5050:Myh7b UTSW 2 155631750 missense probably benign 0.00
R5055:Myh7b UTSW 2 155632373 missense possibly damaging 0.75
R5056:Myh7b UTSW 2 155632373 missense possibly damaging 0.75
R5161:Myh7b UTSW 2 155632373 missense possibly damaging 0.75
R5284:Myh7b UTSW 2 155632314 missense probably benign
R5422:Myh7b UTSW 2 155631034 missense probably damaging 0.99
R5505:Myh7b UTSW 2 155632672 missense probably benign 0.01
R5946:Myh7b UTSW 2 155621395 missense probably damaging 1.00
R6089:Myh7b UTSW 2 155622489 missense probably damaging 1.00
R6103:Myh7b UTSW 2 155618743 missense probably damaging 1.00
R6233:Myh7b UTSW 2 155631799 missense possibly damaging 0.85
R6292:Myh7b UTSW 2 155632396 missense probably damaging 1.00
R6350:Myh7b UTSW 2 155628760 missense probably benign 0.00
R6484:Myh7b UTSW 2 155628643 missense probably benign 0.05
R6760:Myh7b UTSW 2 155620118 nonsense probably null
R6896:Myh7b UTSW 2 155622568 critical splice donor site probably null
R6945:Myh7b UTSW 2 155622232 missense possibly damaging 0.95
R7020:Myh7b UTSW 2 155631751 missense possibly damaging 0.56
R7052:Myh7b UTSW 2 155614133 missense probably damaging 1.00
R7102:Myh7b UTSW 2 155622199 missense probably damaging 1.00
R7248:Myh7b UTSW 2 155622186 missense probably damaging 1.00
R7303:Myh7b UTSW 2 155618740 missense probably damaging 1.00
R7360:Myh7b UTSW 2 155632540 missense probably benign 0.38
R7652:Myh7b UTSW 2 155632236 missense probably damaging 0.99
R7678:Myh7b UTSW 2 155617778 splice site probably null
R7703:Myh7b UTSW 2 155620436 missense probably null 1.00
R7923:Myh7b UTSW 2 155625966 missense probably benign
R7967:Myh7b UTSW 2 155614199 splice site probably null
R8045:Myh7b UTSW 2 155613181 missense probably benign 0.00
R8176:Myh7b UTSW 2 155625966 missense probably benign 0.06
R8272:Myh7b UTSW 2 155632904 missense probably damaging 1.00
X0013:Myh7b UTSW 2 155631169 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGAGGAACTTATCGCCACTG -3'
(R):5'- AAGTTTCCAGGGTAAAGGCC -3'

Sequencing Primer
(F):5'- ATCGCCACTGATGTACGATG -3'
(R):5'- TTTCCAGGGTAAAGGCCAGGTC -3'
Posted On2019-11-12