Incidental Mutation 'R7711:Myh7b'
ID594592
Institutional Source Beutler Lab
Gene Symbol Myh7b
Ensembl Gene ENSMUSG00000074652
Gene Namemyosin, heavy chain 7B, cardiac muscle, beta
SynonymsMyh14
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7711 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location155611212-155634307 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 155620403 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 342 (L342R)
Ref Sequence ENSEMBL: ENSMUSP00000090672 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092995]
Predicted Effect probably damaging
Transcript: ENSMUST00000092995
AA Change: L342R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000090672
Gene: ENSMUSG00000074652
AA Change: L342R

DomainStartEndE-ValueType
Pfam:Myosin_N 32 72 4.7e-14 PFAM
MYSc 78 786 N/A SMART
IQ 787 809 2.6e0 SMART
Pfam:Myosin_tail_1 850 1931 5.5e-149 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a myosin heavy chain. The encoded protein forms a hexamer comprised of two heavy chains, two alkali light chains, and two regulatory light chain components. This complex functions in muscle contraction. [provided by RefSeq, Jun 2013]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik G A 8: 120,159,984 E342K possibly damaging Het
9430015G10Rik T G 4: 156,119,192 V34G probably damaging Het
Alkbh3 T C 2: 94,008,092 S44G probably benign Het
Alpk2 A T 18: 65,306,484 C613S probably benign Het
Aplp2 G A 9: 31,161,349 R488C probably damaging Het
Arid1b A G 17: 5,336,820 N1463S probably benign Het
Atxn2l A T 7: 126,501,269 L125Q probably damaging Het
C130060K24Rik A G 6: 65,441,373 H23R Het
Cd3d A G 9: 44,986,336 K172E probably benign Het
Chd7 T A 4: 8,805,234 D764E probably benign Het
Col19a1 T C 1: 24,530,008 I220V unknown Het
Cpq T C 15: 33,497,347 I411T probably benign Het
Crybg2 C A 4: 134,065,533 H160N probably benign Het
Cryl1 A T 14: 57,275,556 C285S probably benign Het
Dapk1 A G 13: 60,761,551 D1326G probably damaging Het
Dgkh A G 14: 78,725,019 V24A probably benign Het
Dnajb4 A C 3: 152,186,517 S226R probably benign Het
Dnm3 A T 1: 161,992,053 I850N possibly damaging Het
Dtna G T 18: 23,625,196 probably null Het
Efcab6 G T 15: 83,949,924 D494E probably benign Het
Fam169a G T 13: 97,126,688 E550* probably null Het
Fbxw7 A G 3: 84,925,681 N10S probably benign Het
Flrt2 T C 12: 95,780,754 F622S probably damaging Het
Gm17359 A G 3: 79,405,860 I80M probably damaging Het
Gm884 G T 11: 103,614,912 Q2077K probably benign Het
Gm906 T G 13: 50,247,095 R398S probably benign Het
Gprc5d G A 6: 135,116,357 T184I possibly damaging Het
Grem2 A G 1: 174,837,127 V52A probably damaging Het
Gtf3c2 G T 5: 31,170,189 T310N probably damaging Het
H2-Bl T A 17: 36,083,878 N51I probably damaging Het
Hyou1 A G 9: 44,384,462 D338G possibly damaging Het
Ifna6 T C 4: 88,827,734 S107P probably benign Het
Kif14 G T 1: 136,471,453 G451C probably benign Het
Kit T A 5: 75,637,359 F436I probably damaging Het
Lonp2 G A 8: 86,714,008 C751Y probably damaging Het
Lonrf1 C A 8: 36,249,221 G87C probably damaging Het
Lrp2 T C 2: 69,479,343 probably null Het
Mkln1 A G 6: 31,492,649 H598R probably damaging Het
Mmaa T C 8: 79,268,145 H344R probably benign Het
Myh7 C G 14: 54,988,801 D461H probably damaging Het
Olfr1120 A G 2: 87,357,527 N28D probably benign Het
Olfr1291-ps1 T A 2: 111,500,152 I300K probably damaging Het
Olfr18 A T 9: 20,314,023 V299E possibly damaging Het
Olfr753-ps1 C T 17: 37,169,956 G129R probably damaging Het
Pcsk5 T A 19: 17,439,080 Y1668F possibly damaging Het
Pfn4 C T 12: 4,774,414 T47I possibly damaging Het
Pklr T C 3: 89,141,342 L104P probably damaging Het
Plcxd2 A G 16: 45,980,330 V177A probably benign Het
Pramef25 T C 4: 143,949,252 S335G probably benign Het
Prdm10 G T 9: 31,357,232 A826S probably damaging Het
Prrt4 A G 6: 29,177,456 S105P probably benign Het
Prss51 T A 14: 64,097,488 V164E probably damaging Het
Psap T C 10: 60,299,855 V360A probably damaging Het
Psg22 T C 7: 18,718,342 probably null Het
Rad51 A G 2: 119,131,590 Q206R probably benign Het
Rap1gds1 T C 3: 138,959,113 K277R probably benign Het
Rassf2 T A 2: 132,005,377 T103S probably benign Het
Rbm15b T A 9: 106,885,943 H342L possibly damaging Het
Rsf1 G GACCGCGGCC 7: 97,579,909 probably benign Het
Scaf8 T C 17: 3,187,634 F561L probably damaging Het
Scn1a G A 2: 66,303,660 A130V probably benign Het
Scn7a T C 2: 66,700,877 E552G probably damaging Het
Slc39a14 T A 14: 70,313,675 R183W probably damaging Het
Slfn1 A T 11: 83,121,263 K68N possibly damaging Het
Slx4ip A G 2: 137,067,994 D303G probably damaging Het
Snx17 T A 5: 31,195,460 F101Y probably damaging Het
Specc1l C A 10: 75,230,808 N30K probably benign Het
Tbx19 A G 1: 165,139,199 S369P probably benign Het
Usp17ld T C 7: 103,250,282 H481R probably damaging Het
Wnt2 A G 6: 17,990,037 L287P probably benign Het
Zfhx4 G T 3: 5,396,956 M1230I probably damaging Het
Zfp1 T C 8: 111,670,162 C272R not run Het
Zfp458 A G 13: 67,259,600 S64P possibly damaging Het
Other mutations in Myh7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00931:Myh7b APN 2 155630292 missense probably damaging 0.99
IGL01604:Myh7b APN 2 155632407 missense probably damaging 0.96
IGL02179:Myh7b APN 2 155614491 missense probably benign 0.02
IGL02729:Myh7b APN 2 155625689 missense probably damaging 1.00
IGL02804:Myh7b APN 2 155625723 missense probably damaging 1.00
IGL02851:Myh7b APN 2 155628827 missense probably damaging 1.00
IGL02956:Myh7b APN 2 155632903 missense probably damaging 1.00
IGL02956:Myh7b APN 2 155625954 missense possibly damaging 0.95
IGL02992:Myh7b APN 2 155621410 missense probably damaging 0.99
IGL03060:Myh7b APN 2 155632751 missense probably damaging 1.00
IGL03061:Myh7b APN 2 155620111 missense possibly damaging 0.93
IGL03226:Myh7b APN 2 155620483 nonsense probably null
IGL03246:Myh7b APN 2 155617872 missense probably damaging 1.00
IGL03382:Myh7b APN 2 155623479 missense probably damaging 1.00
euclidian UTSW 2 155633399 missense probably benign 0.32
imaginary UTSW 2 155632255 missense probably benign 0.36
Irrational UTSW 2 155630672 unclassified probably benign
Muscoli UTSW 2 155620118 nonsense probably null
R0015:Myh7b UTSW 2 155622286 missense probably damaging 1.00
R0015:Myh7b UTSW 2 155622286 missense probably damaging 1.00
R0109:Myh7b UTSW 2 155611674 missense possibly damaging 0.92
R0309:Myh7b UTSW 2 155630672 unclassified probably benign
R0567:Myh7b UTSW 2 155626398 missense probably damaging 1.00
R0619:Myh7b UTSW 2 155611722 missense probably benign 0.00
R0927:Myh7b UTSW 2 155620120 missense probably damaging 1.00
R0973:Myh7b UTSW 2 155620427 missense probably benign
R0973:Myh7b UTSW 2 155620427 missense probably benign
R0974:Myh7b UTSW 2 155620427 missense probably benign
R1137:Myh7b UTSW 2 155622714 missense probably damaging 1.00
R1261:Myh7b UTSW 2 155621083 missense probably benign 0.00
R1268:Myh7b UTSW 2 155614046 nonsense probably null
R1537:Myh7b UTSW 2 155631787 missense probably damaging 0.96
R1632:Myh7b UTSW 2 155620525 missense probably benign 0.04
R1694:Myh7b UTSW 2 155613193 missense probably damaging 0.99
R1697:Myh7b UTSW 2 155620134 missense probably damaging 1.00
R1730:Myh7b UTSW 2 155625672 missense possibly damaging 0.73
R1762:Myh7b UTSW 2 155630858 missense probably damaging 0.96
R1783:Myh7b UTSW 2 155625672 missense possibly damaging 0.73
R2105:Myh7b UTSW 2 155629457 missense probably benign 0.00
R2140:Myh7b UTSW 2 155620123 missense probably damaging 1.00
R2971:Myh7b UTSW 2 155632255 missense probably benign 0.36
R3838:Myh7b UTSW 2 155632989 missense probably damaging 1.00
R4074:Myh7b UTSW 2 155618758 missense probably damaging 0.96
R4191:Myh7b UTSW 2 155633399 missense probably benign 0.32
R4689:Myh7b UTSW 2 155630514 missense possibly damaging 0.75
R4695:Myh7b UTSW 2 155614177 missense probably damaging 1.00
R4697:Myh7b UTSW 2 155629322 missense probably damaging 1.00
R4771:Myh7b UTSW 2 155626394 nonsense probably null
R4794:Myh7b UTSW 2 155623266 missense probably benign 0.00
R4842:Myh7b UTSW 2 155633989 missense probably benign 0.45
R4871:Myh7b UTSW 2 155613500 missense probably benign 0.18
R5022:Myh7b UTSW 2 155632373 missense possibly damaging 0.75
R5023:Myh7b UTSW 2 155632373 missense possibly damaging 0.75
R5025:Myh7b UTSW 2 155632373 missense possibly damaging 0.75
R5050:Myh7b UTSW 2 155631750 missense probably benign 0.00
R5055:Myh7b UTSW 2 155632373 missense possibly damaging 0.75
R5056:Myh7b UTSW 2 155632373 missense possibly damaging 0.75
R5161:Myh7b UTSW 2 155632373 missense possibly damaging 0.75
R5284:Myh7b UTSW 2 155632314 missense probably benign
R5422:Myh7b UTSW 2 155631034 missense probably damaging 0.99
R5505:Myh7b UTSW 2 155632672 missense probably benign 0.01
R5946:Myh7b UTSW 2 155621395 missense probably damaging 1.00
R6089:Myh7b UTSW 2 155622489 missense probably damaging 1.00
R6103:Myh7b UTSW 2 155618743 missense probably damaging 1.00
R6233:Myh7b UTSW 2 155631799 missense possibly damaging 0.85
R6292:Myh7b UTSW 2 155632396 missense probably damaging 1.00
R6350:Myh7b UTSW 2 155628760 missense probably benign 0.00
R6484:Myh7b UTSW 2 155628643 missense probably benign 0.05
R6760:Myh7b UTSW 2 155620118 nonsense probably null
R6896:Myh7b UTSW 2 155622568 critical splice donor site probably null
R6945:Myh7b UTSW 2 155622232 missense possibly damaging 0.95
R7020:Myh7b UTSW 2 155631751 missense possibly damaging 0.56
R7052:Myh7b UTSW 2 155614133 missense probably damaging 1.00
R7102:Myh7b UTSW 2 155622199 missense probably damaging 1.00
R7248:Myh7b UTSW 2 155622186 missense probably damaging 1.00
R7303:Myh7b UTSW 2 155618740 missense probably damaging 1.00
R7360:Myh7b UTSW 2 155632540 missense probably benign 0.38
R7652:Myh7b UTSW 2 155632236 missense probably damaging 0.99
R7703:Myh7b UTSW 2 155620436 missense probably null 1.00
X0013:Myh7b UTSW 2 155631169 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGAGGAACTTATCGCCACTG -3'
(R):5'- AAGTTTCCAGGGTAAAGGCC -3'

Sequencing Primer
(F):5'- ATCGCCACTGATGTACGATG -3'
(R):5'- TTTCCAGGGTAAAGGCCAGGTC -3'
Posted On2019-11-12