Incidental Mutation 'R7711:Gm906'
ID594633
Institutional Source Beutler Lab
Gene Symbol Gm906
Ensembl Gene ENSMUSG00000095300
Gene Namepredicted gene 906
SynonymsLOC380882
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R7711 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location50245181-50250308 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 50247095 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 398 (R398S)
Ref Sequence ENSEMBL: ENSMUSP00000097121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099521]
Predicted Effect probably benign
Transcript: ENSMUST00000099521
AA Change: R398S

PolyPhen 2 Score 0.428 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000097121
Gene: ENSMUSG00000095300
AA Change: R398S

DomainStartEndE-ValueType
low complexity region 69 82 N/A INTRINSIC
Pfam:FAM75 96 414 5.3e-15 PFAM
SCOP:d1i5pa1 811 874 1e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik G A 8: 120,159,984 E342K possibly damaging Het
9430015G10Rik T G 4: 156,119,192 V34G probably damaging Het
Alkbh3 T C 2: 94,008,092 S44G probably benign Het
Alpk2 A T 18: 65,306,484 C613S probably benign Het
Aplp2 G A 9: 31,161,349 R488C probably damaging Het
Arid1b A G 17: 5,336,820 N1463S probably benign Het
Atxn2l A T 7: 126,501,269 L125Q probably damaging Het
C130060K24Rik A G 6: 65,441,373 H23R Het
Cd3d A G 9: 44,986,336 K172E probably benign Het
Chd7 T A 4: 8,805,234 D764E probably benign Het
Col19a1 T C 1: 24,530,008 I220V unknown Het
Cpq T C 15: 33,497,347 I411T probably benign Het
Crybg2 C A 4: 134,065,533 H160N probably benign Het
Cryl1 A T 14: 57,275,556 C285S probably benign Het
Dapk1 A G 13: 60,761,551 D1326G probably damaging Het
Dgkh A G 14: 78,725,019 V24A probably benign Het
Dnajb4 A C 3: 152,186,517 S226R probably benign Het
Dnm3 A T 1: 161,992,053 I850N possibly damaging Het
Dtna G T 18: 23,625,196 probably null Het
Efcab6 G T 15: 83,949,924 D494E probably benign Het
Fam169a G T 13: 97,126,688 E550* probably null Het
Fbxw7 A G 3: 84,925,681 N10S probably benign Het
Flrt2 T C 12: 95,780,754 F622S probably damaging Het
Gm17359 A G 3: 79,405,860 I80M probably damaging Het
Gm884 G T 11: 103,614,912 Q2077K probably benign Het
Gprc5d G A 6: 135,116,357 T184I possibly damaging Het
Grem2 A G 1: 174,837,127 V52A probably damaging Het
Gtf3c2 G T 5: 31,170,189 T310N probably damaging Het
H2-Bl T A 17: 36,083,878 N51I probably damaging Het
Hyou1 A G 9: 44,384,462 D338G possibly damaging Het
Ifna6 T C 4: 88,827,734 S107P probably benign Het
Kif14 G T 1: 136,471,453 G451C probably benign Het
Kit T A 5: 75,637,359 F436I probably damaging Het
Lonp2 G A 8: 86,714,008 C751Y probably damaging Het
Lonrf1 C A 8: 36,249,221 G87C probably damaging Het
Lrp2 T C 2: 69,479,343 probably null Het
Mkln1 A G 6: 31,492,649 H598R probably damaging Het
Mmaa T C 8: 79,268,145 H344R probably benign Het
Myh7 C G 14: 54,988,801 D461H probably damaging Het
Myh7b T G 2: 155,620,403 L342R probably damaging Het
Olfr1120 A G 2: 87,357,527 N28D probably benign Het
Olfr1291-ps1 T A 2: 111,500,152 I300K probably damaging Het
Olfr18 A T 9: 20,314,023 V299E possibly damaging Het
Olfr753-ps1 C T 17: 37,169,956 G129R probably damaging Het
Pcsk5 T A 19: 17,439,080 Y1668F possibly damaging Het
Pfn4 C T 12: 4,774,414 T47I possibly damaging Het
Pklr T C 3: 89,141,342 L104P probably damaging Het
Plcxd2 A G 16: 45,980,330 V177A probably benign Het
Pramef25 T C 4: 143,949,252 S335G probably benign Het
Prdm10 G T 9: 31,357,232 A826S probably damaging Het
Prrt4 A G 6: 29,177,456 S105P probably benign Het
Prss51 T A 14: 64,097,488 V164E probably damaging Het
Psap T C 10: 60,299,855 V360A probably damaging Het
Psg22 T C 7: 18,718,342 probably null Het
Rad51 A G 2: 119,131,590 Q206R probably benign Het
Rap1gds1 T C 3: 138,959,113 K277R probably benign Het
Rassf2 T A 2: 132,005,377 T103S probably benign Het
Rbm15b T A 9: 106,885,943 H342L possibly damaging Het
Rsf1 G GACCGCGGCC 7: 97,579,909 probably benign Het
Scaf8 T C 17: 3,187,634 F561L probably damaging Het
Scn1a G A 2: 66,303,660 A130V probably benign Het
Scn7a T C 2: 66,700,877 E552G probably damaging Het
Slc39a14 T A 14: 70,313,675 R183W probably damaging Het
Slfn1 A T 11: 83,121,263 K68N possibly damaging Het
Slx4ip A G 2: 137,067,994 D303G probably damaging Het
Snx17 T A 5: 31,195,460 F101Y probably damaging Het
Specc1l C A 10: 75,230,808 N30K probably benign Het
Tbx19 A G 1: 165,139,199 S369P probably benign Het
Usp17ld T C 7: 103,250,282 H481R probably damaging Het
Wnt2 A G 6: 17,990,037 L287P probably benign Het
Zfhx4 G T 3: 5,396,956 M1230I probably damaging Het
Zfp1 T C 8: 111,670,162 C272R not run Het
Zfp458 A G 13: 67,259,600 S64P possibly damaging Het
Other mutations in Gm906
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00575:Gm906 APN 13 50246716 missense probably damaging 1.00
IGL02008:Gm906 APN 13 50246685 missense probably benign 0.00
R0464:Gm906 UTSW 13 50248275 splice site probably benign
R0481:Gm906 UTSW 13 50246964 missense probably benign 0.33
R0781:Gm906 UTSW 13 50248260 missense possibly damaging 0.70
R1110:Gm906 UTSW 13 50248260 missense possibly damaging 0.70
R1945:Gm906 UTSW 13 50245491 missense probably damaging 1.00
R3119:Gm906 UTSW 13 50246969 nonsense probably null
R3824:Gm906 UTSW 13 50245512 missense possibly damaging 0.73
R3861:Gm906 UTSW 13 50246851 missense probably benign 0.00
R4256:Gm906 UTSW 13 50250105 missense probably benign 0.18
R4607:Gm906 UTSW 13 50245506 missense possibly damaging 0.86
R6126:Gm906 UTSW 13 50246290 missense probably benign 0.18
R6550:Gm906 UTSW 13 50245446 missense probably benign 0.00
R6913:Gm906 UTSW 13 50245257 missense probably damaging 0.99
R6970:Gm906 UTSW 13 50246971 missense possibly damaging 0.86
R7339:Gm906 UTSW 13 50247168 missense possibly damaging 0.86
R7347:Gm906 UTSW 13 50245744 missense probably benign 0.01
R7607:Gm906 UTSW 13 50250260 missense possibly damaging 0.72
R7655:Gm906 UTSW 13 50247086 missense probably benign 0.00
R7656:Gm906 UTSW 13 50247086 missense probably benign 0.00
R7803:Gm906 UTSW 13 50246190 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- AGGTTTGAGGCTGGAACTCC -3'
(R):5'- TTCATTATTGCAAGAACAGGCCTC -3'

Sequencing Primer
(F):5'- TCCAGGTGGGGTCAGATC -3'
(R):5'- TTATTGCAAGAACAGGCCTCAACTC -3'
Posted On2019-11-12