Incidental Mutation 'R0241:Ddx31'
ID 59464
Institutional Source Beutler Lab
Gene Symbol Ddx31
Ensembl Gene ENSMUSG00000026806
Gene Name DEAD/H box helicase 31
Synonyms 5830444G11Rik, DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 31
MMRRC Submission 038479-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.855) question?
Stock # R0241 (G1)
Quality Score 177
Status Validated
Chromosome 2
Chromosomal Location 28730418-28795583 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 28738303 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 155 (T155A)
Ref Sequence ENSEMBL: ENSMUSP00000109484 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113853]
AlphaFold Q6NZQ2
Predicted Effect probably damaging
Transcript: ENSMUST00000113853
AA Change: T155A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109484
Gene: ENSMUSG00000026806
AA Change: T155A

DomainStartEndE-ValueType
DEXDc 123 332 2.28e-48 SMART
HELICc 408 487 4.02e-26 SMART
DUF4217 556 621 6.21e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147071
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147779
Meta Mutation Damage Score 0.9621 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this DEAD box protein family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a member of this family. The function of this member has not been determined. Alternative splicing of this gene generates multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2016]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adck2 T A 6: 39,560,752 (GRCm39) V380E probably benign Het
Anapc1 A T 2: 128,470,549 (GRCm39) M1527K possibly damaging Het
Arfgef3 T A 10: 18,474,962 (GRCm39) I1575F probably damaging Het
Atp4a G T 7: 30,416,560 (GRCm39) G446C probably benign Het
Bicra A T 7: 15,709,070 (GRCm39) M1188K probably damaging Het
Brd7 G A 8: 89,072,478 (GRCm39) R331W probably benign Het
Cactin A G 10: 81,158,486 (GRCm39) T151A probably benign Het
Cadps G A 14: 12,376,675 (GRCm38) T1274M probably damaging Het
Catsper3 T C 13: 55,952,667 (GRCm39) M175T probably damaging Het
Chd5 A G 4: 152,450,589 (GRCm39) D605G probably damaging Het
Chst12 G A 5: 140,510,054 (GRCm39) R227H possibly damaging Het
Cic T A 7: 24,986,565 (GRCm39) S1299T probably damaging Het
Cic C A 7: 24,986,566 (GRCm39) S1299Y probably damaging Het
Cimap1d C T 10: 79,480,564 (GRCm39) probably null Het
Cobl A T 11: 12,204,524 (GRCm39) V644E probably benign Het
Dnah3 T C 7: 119,521,953 (GRCm39) Q4069R probably damaging Het
Dnah8 T C 17: 30,984,653 (GRCm39) I3117T probably damaging Het
Doc2b A G 11: 75,663,387 (GRCm39) V355A probably damaging Het
Dock10 A T 1: 80,556,340 (GRCm39) S578T probably benign Het
Duox1 T C 2: 122,163,878 (GRCm39) probably benign Het
Epb41l5 T C 1: 119,495,509 (GRCm39) probably null Het
Fbp2 A T 13: 63,001,862 (GRCm39) F118I probably damaging Het
Fcer2a A G 8: 3,738,796 (GRCm39) probably null Het
Fmnl1 G A 11: 103,072,996 (GRCm39) probably null Het
Fry A T 5: 150,183,811 (GRCm39) probably benign Het
Git2 T C 5: 114,871,290 (GRCm39) E208G probably damaging Het
Hs6st3 T C 14: 119,376,232 (GRCm39) F136L probably benign Het
Hydin G A 8: 111,124,655 (GRCm39) V555I probably benign Het
Kcns1 A T 2: 164,010,300 (GRCm39) I153N probably damaging Het
Kmt2b A G 7: 30,276,494 (GRCm39) L1726S probably damaging Het
Loxl3 A G 6: 83,027,114 (GRCm39) D615G probably damaging Het
Negr1 T A 3: 156,914,036 (GRCm39) probably benign Het
Nfasc C A 1: 132,564,731 (GRCm39) A70S probably benign Het
Or4d1 T A 11: 87,804,860 (GRCm39) N291Y probably damaging Het
Or4p21 A T 2: 88,276,889 (GRCm39) M131K possibly damaging Het
Or52n4 A G 7: 104,294,450 (GRCm39) M41T probably benign Het
Or5g29 A G 2: 85,421,154 (GRCm39) K90R probably benign Het
Otud7a T C 7: 63,346,992 (GRCm39) probably benign Het
Pacs2 T C 12: 113,032,890 (GRCm39) probably benign Het
Pde7b A G 10: 20,311,962 (GRCm39) C239R probably damaging Het
Pdzd2 A T 15: 12,368,027 (GRCm39) L2654Q probably damaging Het
Pgap1 T C 1: 54,575,110 (GRCm39) probably null Het
Proz T A 8: 13,115,356 (GRCm39) M124K probably benign Het
Raet1d A G 10: 22,247,328 (GRCm39) T135A probably benign Het
Rapgef1 A G 2: 29,592,682 (GRCm39) N558S possibly damaging Het
Rpl7 C G 1: 16,173,446 (GRCm39) G101A possibly damaging Het
Sec14l1 G A 11: 117,037,924 (GRCm39) probably benign Het
Sfi1 CCTCTC CCTCTCTC 11: 3,127,419 (GRCm39) probably benign Het
Simc1 G T 13: 54,698,338 (GRCm39) L1319F probably damaging Het
Sspo A G 6: 48,438,429 (GRCm39) E1499G possibly damaging Het
Tango6 C T 8: 107,473,993 (GRCm39) probably benign Het
Tas2r118 T C 6: 23,969,338 (GRCm39) Y241C probably damaging Het
Tbck A G 3: 132,430,636 (GRCm39) E344G probably benign Het
Tcam1 G A 11: 106,174,904 (GRCm39) E120K probably benign Het
Thop1 T A 10: 80,916,079 (GRCm39) probably benign Het
Tmbim7 A T 5: 3,716,866 (GRCm39) Y66F probably benign Het
Tmc8 C T 11: 117,677,207 (GRCm39) probably benign Het
Tnfrsf19 A G 14: 61,211,041 (GRCm39) S216P possibly damaging Het
Trappc2l A G 8: 123,341,132 (GRCm39) probably benign Het
Trim67 A G 8: 125,549,929 (GRCm39) R520G probably damaging Het
Ubp1 T A 9: 113,795,655 (GRCm39) probably null Het
Vil1 T C 1: 74,465,853 (GRCm39) L548P probably damaging Het
Wdr3 A G 3: 100,052,973 (GRCm39) V593A probably damaging Het
Wdr5 A G 2: 27,423,025 (GRCm39) Y243C probably damaging Het
Zan T C 5: 137,420,084 (GRCm39) T2858A unknown Het
Zbtb37 A T 1: 160,847,939 (GRCm39) V356E probably benign Het
Zfp36 C T 7: 28,077,759 (GRCm39) V50I probably damaging Het
Zfp563 A T 17: 33,323,659 (GRCm39) S85C possibly damaging Het
Other mutations in Ddx31
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01664:Ddx31 APN 2 28,765,847 (GRCm39) splice site probably benign
IGL01918:Ddx31 APN 2 28,764,176 (GRCm39) missense probably damaging 1.00
IGL02174:Ddx31 APN 2 28,749,041 (GRCm39) missense probably damaging 1.00
IGL02560:Ddx31 APN 2 28,765,838 (GRCm39) missense probably damaging 1.00
IGL02938:Ddx31 APN 2 28,749,035 (GRCm39) missense possibly damaging 0.49
R0241:Ddx31 UTSW 2 28,738,303 (GRCm39) missense probably damaging 1.00
R0440:Ddx31 UTSW 2 28,747,144 (GRCm39) missense probably damaging 1.00
R0701:Ddx31 UTSW 2 28,748,789 (GRCm39) missense probably null 1.00
R0729:Ddx31 UTSW 2 28,764,186 (GRCm39) missense probably damaging 1.00
R1227:Ddx31 UTSW 2 28,747,187 (GRCm39) missense probably damaging 1.00
R1532:Ddx31 UTSW 2 28,771,171 (GRCm39) missense probably benign 0.00
R1608:Ddx31 UTSW 2 28,749,078 (GRCm39) missense probably damaging 0.97
R1646:Ddx31 UTSW 2 28,782,532 (GRCm39) missense probably benign
R1674:Ddx31 UTSW 2 28,748,828 (GRCm39) missense probably damaging 1.00
R1834:Ddx31 UTSW 2 28,782,465 (GRCm39) missense probably damaging 1.00
R1884:Ddx31 UTSW 2 28,749,002 (GRCm39) missense probably damaging 0.97
R4133:Ddx31 UTSW 2 28,748,864 (GRCm39) missense probably damaging 1.00
R4911:Ddx31 UTSW 2 28,794,696 (GRCm39) missense probably benign 0.00
R4972:Ddx31 UTSW 2 28,750,782 (GRCm39) missense probably damaging 1.00
R5240:Ddx31 UTSW 2 28,736,042 (GRCm39) missense probably benign 0.03
R5358:Ddx31 UTSW 2 28,753,782 (GRCm39) missense probably damaging 0.98
R5450:Ddx31 UTSW 2 28,776,981 (GRCm39) missense probably damaging 0.97
R5945:Ddx31 UTSW 2 28,749,902 (GRCm39) missense probably damaging 1.00
R5956:Ddx31 UTSW 2 28,764,185 (GRCm39) missense probably damaging 1.00
R6235:Ddx31 UTSW 2 28,734,854 (GRCm39) missense probably benign 0.00
R6245:Ddx31 UTSW 2 28,734,994 (GRCm39) missense probably benign 0.00
R6463:Ddx31 UTSW 2 28,737,525 (GRCm39) critical splice donor site probably null
R6647:Ddx31 UTSW 2 28,765,750 (GRCm39) missense probably damaging 1.00
R6783:Ddx31 UTSW 2 28,764,188 (GRCm39) missense probably benign 0.26
R6917:Ddx31 UTSW 2 28,782,421 (GRCm39) missense probably damaging 1.00
R7135:Ddx31 UTSW 2 28,738,318 (GRCm39) missense probably benign
R7819:Ddx31 UTSW 2 28,782,463 (GRCm39) missense probably damaging 1.00
R8812:Ddx31 UTSW 2 28,730,816 (GRCm39) unclassified probably benign
R9122:Ddx31 UTSW 2 28,748,753 (GRCm39) missense probably damaging 1.00
R9326:Ddx31 UTSW 2 28,749,008 (GRCm39) missense probably damaging 1.00
R9571:Ddx31 UTSW 2 28,750,034 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTGAAAGGCACCATAGCTCCCTTG -3'
(R):5'- TGACCTATATGCCCTACACACGGAC -3'

Sequencing Primer
(F):5'- CCCTTGTAGATAACCTAAGGAGCTG -3'
(R):5'- GACCGTGAAGAGTTTATTCTACTCC -3'
Posted On 2013-07-11