Incidental Mutation 'R7711:Dtna'
ID 594649
Institutional Source Beutler Lab
Gene Symbol Dtna
Ensembl Gene ENSMUSG00000024302
Gene Name dystrobrevin alpha
Synonyms a-DB-1, A0, alpha-dystrobrevin, 2210407P21Rik, 87K protein, Dtn, adbn
MMRRC Submission 045769-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.207) question?
Stock # R7711 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 23548192-23792772 bp(+) (GRCm39)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to T at 23758253 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115832] [ENSMUST00000220904] [ENSMUST00000221880]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000115832
SMART Domains Protein: ENSMUSP00000111498
Gene: ENSMUSG00000024302

DomainStartEndE-ValueType
Pfam:EF-hand_2 16 140 1.7e-37 PFAM
Pfam:EF-hand_3 144 232 1.6e-32 PFAM
ZnF_ZZ 237 282 1.29e-17 SMART
SCOP:d1eq1a_ 361 494 5e-3 SMART
low complexity region 499 514 N/A INTRINSIC
coiled coil region 650 677 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000220904
Predicted Effect probably null
Transcript: ENSMUST00000221880
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the dystrobrevin subfamily of the dystrophin family. This protein is a component of the dystrophin-associated protein complex (DPC), which consists of dystrophin and several integral and peripheral membrane proteins, including dystroglycans, sarcoglycans, syntrophins and alpha- and beta-dystrobrevin. The DPC localizes to the sarcolemma and its disruption is associated with various forms of muscular dystrophy. Mutations in this gene are associated with left ventricular noncompaction with congenital heart defects. Multiple alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous targeted mutants exhibit skeletal and cardiac myopathies. Neuromuscular junctions appear to form normally, but their postnatal maturation is compromised. Dtna mutations do not increase the severity of Dmd or Utrn mutants whose products are also part of the dystrophin-glycoprotein complex. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik G A 8: 120,886,723 (GRCm39) E342K possibly damaging Het
9430015G10Rik T G 4: 156,203,649 (GRCm39) V34G probably damaging Het
Alkbh3 T C 2: 93,838,437 (GRCm39) S44G probably benign Het
Alpk2 A T 18: 65,439,555 (GRCm39) C613S probably benign Het
Aplp2 G A 9: 31,072,645 (GRCm39) R488C probably damaging Het
Arid1b A G 17: 5,387,095 (GRCm39) N1463S probably benign Het
Atxn2l A T 7: 126,100,441 (GRCm39) L125Q probably damaging Het
Cd3d A G 9: 44,897,634 (GRCm39) K172E probably benign Het
Chd7 T A 4: 8,805,234 (GRCm39) D764E probably benign Het
Col19a1 T C 1: 24,569,089 (GRCm39) I220V unknown Het
Cpq T C 15: 33,497,493 (GRCm39) I411T probably benign Het
Crybg2 C A 4: 133,792,844 (GRCm39) H160N probably benign Het
Cryl1 A T 14: 57,513,013 (GRCm39) C285S probably benign Het
Dapk1 A G 13: 60,909,365 (GRCm39) D1326G probably damaging Het
Dgkh A G 14: 78,962,459 (GRCm39) V24A probably benign Het
Dnajb4 A C 3: 151,892,154 (GRCm39) S226R probably benign Het
Dnm3 A T 1: 161,819,622 (GRCm39) I850N possibly damaging Het
Efcab6 G T 15: 83,834,125 (GRCm39) D494E probably benign Het
Fam169a G T 13: 97,263,196 (GRCm39) E550* probably null Het
Fbxw7 A G 3: 84,832,988 (GRCm39) N10S probably benign Het
Flrt2 T C 12: 95,747,528 (GRCm39) F622S probably damaging Het
Gprc5d G A 6: 135,093,355 (GRCm39) T184I possibly damaging Het
Grem2 A G 1: 174,664,693 (GRCm39) V52A probably damaging Het
Gtf3c2 G T 5: 31,327,533 (GRCm39) T310N probably damaging Het
H2-T13 T A 17: 36,394,770 (GRCm39) N51I probably damaging Het
Hyou1 A G 9: 44,295,759 (GRCm39) D338G possibly damaging Het
Ifna6 T C 4: 88,745,971 (GRCm39) S107P probably benign Het
Kif14 G T 1: 136,399,191 (GRCm39) G451C probably benign Het
Kit T A 5: 75,798,019 (GRCm39) F436I probably damaging Het
Lonp2 G A 8: 87,440,636 (GRCm39) C751Y probably damaging Het
Lonrf1 C A 8: 36,716,375 (GRCm39) G87C probably damaging Het
Lrp2 T C 2: 69,309,687 (GRCm39) probably null Het
Lrrc37 G T 11: 103,505,738 (GRCm39) Q2077K probably benign Het
Mkln1 A G 6: 31,469,584 (GRCm39) H598R probably damaging Het
Mmaa T C 8: 79,994,774 (GRCm39) H344R probably benign Het
Myh7 C G 14: 55,226,258 (GRCm39) D461H probably damaging Het
Myh7b T G 2: 155,462,323 (GRCm39) L342R probably damaging Het
Or12e8 A G 2: 87,187,871 (GRCm39) N28D probably benign Het
Or2h2b-ps1 C T 17: 37,480,847 (GRCm39) G129R probably damaging Het
Or4f4-ps1 T A 2: 111,330,497 (GRCm39) I300K probably damaging Het
Or7e178 A T 9: 20,225,319 (GRCm39) V299E possibly damaging Het
Pcsk5 T A 19: 17,416,444 (GRCm39) Y1668F possibly damaging Het
Pfn4 C T 12: 4,824,414 (GRCm39) T47I possibly damaging Het
Pklr T C 3: 89,048,649 (GRCm39) L104P probably damaging Het
Plcxd2 A G 16: 45,800,693 (GRCm39) V177A probably benign Het
Pramel16 T C 4: 143,675,822 (GRCm39) S335G probably benign Het
Prdm10 G T 9: 31,268,528 (GRCm39) A826S probably damaging Het
Prrt4 A G 6: 29,177,455 (GRCm39) S105P probably benign Het
Prss51 T A 14: 64,334,937 (GRCm39) V164E probably damaging Het
Psap T C 10: 60,135,634 (GRCm39) V360A probably damaging Het
Psg22 T C 7: 18,452,267 (GRCm39) probably null Het
Qrfprl A G 6: 65,418,357 (GRCm39) H23R Het
Rad51 A G 2: 118,962,071 (GRCm39) Q206R probably benign Het
Rap1gds1 T C 3: 138,664,874 (GRCm39) K277R probably benign Het
Rassf2 T A 2: 131,847,297 (GRCm39) T103S probably benign Het
Rbm15b T A 9: 106,763,142 (GRCm39) H342L possibly damaging Het
Rsf1 G GACCGCGGCC 7: 97,229,116 (GRCm39) probably benign Het
Scaf8 T C 17: 3,237,909 (GRCm39) F561L probably damaging Het
Scn1a G A 2: 66,134,004 (GRCm39) A130V probably benign Het
Scn7a T C 2: 66,531,221 (GRCm39) E552G probably damaging Het
Slc39a14 T A 14: 70,551,124 (GRCm39) R183W probably damaging Het
Slfn1 A T 11: 83,012,089 (GRCm39) K68N possibly damaging Het
Slx4ip A G 2: 136,909,914 (GRCm39) D303G probably damaging Het
Snx17 T A 5: 31,352,804 (GRCm39) F101Y probably damaging Het
Spata31e3 T G 13: 50,401,131 (GRCm39) R398S probably benign Het
Specc1l C A 10: 75,066,642 (GRCm39) N30K probably benign Het
Spmip2 A G 3: 79,313,167 (GRCm39) I80M probably damaging Het
Tbx19 A G 1: 164,966,768 (GRCm39) S369P probably benign Het
Usp17ld T C 7: 102,899,489 (GRCm39) H481R probably damaging Het
Wnt2 A G 6: 17,990,036 (GRCm39) L287P probably benign Het
Zfhx4 G T 3: 5,462,016 (GRCm39) M1230I probably damaging Het
Zfp1 T C 8: 112,396,794 (GRCm39) C272R not run Het
Zfp458 A G 13: 67,407,664 (GRCm39) S64P possibly damaging Het
Other mutations in Dtna
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00836:Dtna APN 18 23,730,545 (GRCm39) missense probably benign 0.22
IGL01620:Dtna APN 18 23,758,144 (GRCm39) missense probably damaging 1.00
IGL01705:Dtna APN 18 23,678,788 (GRCm39) missense probably damaging 1.00
IGL01914:Dtna APN 18 23,730,516 (GRCm39) missense possibly damaging 0.62
IGL02388:Dtna APN 18 23,730,571 (GRCm39) missense probably benign 0.00
IGL02427:Dtna APN 18 23,784,595 (GRCm39) missense possibly damaging 0.95
IGL03074:Dtna APN 18 23,735,662 (GRCm39) missense possibly damaging 0.74
R0041:Dtna UTSW 18 23,779,932 (GRCm39) unclassified probably benign
R0041:Dtna UTSW 18 23,779,932 (GRCm39) unclassified probably benign
R0078:Dtna UTSW 18 23,754,499 (GRCm39) missense probably damaging 1.00
R0390:Dtna UTSW 18 23,730,558 (GRCm39) missense probably damaging 1.00
R1808:Dtna UTSW 18 23,702,697 (GRCm39) missense probably damaging 1.00
R1872:Dtna UTSW 18 23,730,617 (GRCm39) critical splice donor site probably null
R2095:Dtna UTSW 18 23,702,805 (GRCm39) missense probably damaging 1.00
R2216:Dtna UTSW 18 23,702,622 (GRCm39) missense probably damaging 1.00
R2295:Dtna UTSW 18 23,764,469 (GRCm39) missense probably damaging 1.00
R2402:Dtna UTSW 18 23,728,535 (GRCm39) nonsense probably null
R2846:Dtna UTSW 18 23,784,560 (GRCm39) splice site probably null
R3836:Dtna UTSW 18 23,758,159 (GRCm39) missense probably damaging 1.00
R4764:Dtna UTSW 18 23,668,206 (GRCm39) splice site probably null
R4893:Dtna UTSW 18 23,702,724 (GRCm39) missense probably damaging 0.99
R5194:Dtna UTSW 18 23,723,302 (GRCm39) nonsense probably null
R5373:Dtna UTSW 18 23,784,670 (GRCm39) missense probably damaging 1.00
R5374:Dtna UTSW 18 23,784,670 (GRCm39) missense probably damaging 1.00
R5526:Dtna UTSW 18 23,779,287 (GRCm39) missense probably damaging 0.99
R5755:Dtna UTSW 18 23,754,520 (GRCm39) missense probably benign
R5769:Dtna UTSW 18 23,784,611 (GRCm39) missense probably benign 0.27
R6062:Dtna UTSW 18 23,755,113 (GRCm39) missense possibly damaging 0.87
R6413:Dtna UTSW 18 23,755,071 (GRCm39) missense probably damaging 1.00
R6876:Dtna UTSW 18 23,744,167 (GRCm39) missense probably benign 0.00
R7103:Dtna UTSW 18 23,786,436 (GRCm39) critical splice donor site probably null
R7804:Dtna UTSW 18 23,728,666 (GRCm39) missense probably damaging 0.97
R8156:Dtna UTSW 18 23,723,388 (GRCm39) nonsense probably null
R8437:Dtna UTSW 18 23,723,398 (GRCm39) nonsense probably null
R8786:Dtna UTSW 18 23,716,190 (GRCm39) missense probably benign 0.10
R9038:Dtna UTSW 18 23,743,553 (GRCm39) missense probably benign
R9268:Dtna UTSW 18 23,702,643 (GRCm39) missense possibly damaging 0.93
R9416:Dtna UTSW 18 23,780,112 (GRCm39) critical splice donor site probably null
R9578:Dtna UTSW 18 23,728,612 (GRCm39) missense probably damaging 0.98
R9605:Dtna UTSW 18 23,764,454 (GRCm39) missense probably damaging 1.00
R9638:Dtna UTSW 18 23,744,122 (GRCm39) missense probably benign
X0063:Dtna UTSW 18 23,776,225 (GRCm39) missense probably damaging 0.98
X0066:Dtna UTSW 18 23,726,038 (GRCm39) missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- ATCCATGTCAGTGTCGTGGG -3'
(R):5'- AGCTCAAACACTGTGGCTGG -3'

Sequencing Primer
(F):5'- GGAGACCACTGACACTGGTTCTTAC -3'
(R):5'- AATACTCTTCGTGCAGAGGC -3'
Posted On 2019-11-12