Incidental Mutation 'R7712:Zdbf2'
ID594653
Institutional Source Beutler Lab
Gene Symbol Zdbf2
Ensembl Gene ENSMUSG00000027520
Gene Namezinc finger, DBF-type containing 2
Synonyms4930431J08Rik, 9330107J05Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R7712 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location63273265-63314576 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 63305371 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 970 (S970P)
Ref Sequence ENSEMBL: ENSMUSP00000029025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029025] [ENSMUST00000114132]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029025
AA Change: S970P

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000029025
Gene: ENSMUSG00000027520
AA Change: S970P

DomainStartEndE-ValueType
low complexity region 79 99 N/A INTRINSIC
low complexity region 150 164 N/A INTRINSIC
low complexity region 378 405 N/A INTRINSIC
internal_repeat_6 407 565 7.68e-5 PROSPERO
internal_repeat_5 418 768 5.53e-5 PROSPERO
internal_repeat_1 618 873 3.17e-15 PROSPERO
internal_repeat_4 621 885 2.09e-6 PROSPERO
internal_repeat_3 642 886 1.52e-7 PROSPERO
internal_repeat_2 650 912 5.87e-11 PROSPERO
internal_repeat_6 722 891 7.68e-5 PROSPERO
low complexity region 965 982 N/A INTRINSIC
internal_repeat_4 1061 1328 2.09e-6 PROSPERO
internal_repeat_2 1215 1484 5.87e-11 PROSPERO
internal_repeat_3 1287 1507 1.52e-7 PROSPERO
internal_repeat_1 1307 1536 3.17e-15 PROSPERO
internal_repeat_5 1388 1758 5.53e-5 PROSPERO
low complexity region 1767 1778 N/A INTRINSIC
low complexity region 2211 2235 N/A INTRINSIC
low complexity region 2240 2399 N/A INTRINSIC
low complexity region 2402 2420 N/A INTRINSIC
low complexity region 2446 2458 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114132
AA Change: S970P

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000109767
Gene: ENSMUSG00000027520
AA Change: S970P

DomainStartEndE-ValueType
low complexity region 79 99 N/A INTRINSIC
low complexity region 150 164 N/A INTRINSIC
low complexity region 378 405 N/A INTRINSIC
internal_repeat_6 407 565 7.68e-5 PROSPERO
internal_repeat_5 418 768 5.53e-5 PROSPERO
internal_repeat_1 618 873 3.17e-15 PROSPERO
internal_repeat_4 621 885 2.09e-6 PROSPERO
internal_repeat_3 642 886 1.52e-7 PROSPERO
internal_repeat_2 650 912 5.87e-11 PROSPERO
internal_repeat_6 722 891 7.68e-5 PROSPERO
low complexity region 965 982 N/A INTRINSIC
internal_repeat_4 1061 1328 2.09e-6 PROSPERO
internal_repeat_2 1215 1484 5.87e-11 PROSPERO
internal_repeat_3 1287 1507 1.52e-7 PROSPERO
internal_repeat_1 1307 1536 3.17e-15 PROSPERO
internal_repeat_5 1388 1758 5.53e-5 PROSPERO
low complexity region 1767 1778 N/A INTRINSIC
low complexity region 2211 2235 N/A INTRINSIC
low complexity region 2240 2399 N/A INTRINSIC
low complexity region 2402 2420 N/A INTRINSIC
low complexity region 2446 2458 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing DBF4-type zinc finger domains. This gene is imprinted and paternally expressed in lymphocytes but is more stochastically expressed in the placenta. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb A C 5: 114,165,738 D74A probably benign Het
Alox15 T C 11: 70,350,253 probably null Het
Ano5 A G 7: 51,573,057 T455A probably benign Het
Ano5 T G 7: 51,590,655 I827S probably damaging Het
Arid1a G A 4: 133,752,611 A334V probably benign Het
Atp13a4 A G 16: 29,459,487 C298R Het
Atp4a T A 7: 30,715,553 S256T probably damaging Het
Atp6v1c1 G A 15: 38,686,805 V215I probably benign Het
Bbs9 T A 9: 22,670,813 F600L probably benign Het
Bmp8b A T 4: 123,124,464 Y376F possibly damaging Het
Cacna2d1 A T 5: 16,362,349 D986V probably damaging Het
Ccdc162 A G 10: 41,627,227 F973S possibly damaging Het
Ccdc177 G A 12: 80,757,938 Q521* probably null Het
Cd209b T A 8: 3,923,299 E158D possibly damaging Het
Cdk14 G A 5: 5,380,061 T22I possibly damaging Het
Chl1 A T 6: 103,711,102 I968F possibly damaging Het
Cnot7 T C 8: 40,494,081 Y255C probably damaging Het
Col4a2 T A 8: 11,425,376 L600H probably benign Het
Cpne7 C A 8: 123,124,181 L129M probably damaging Het
Cpxm2 G T 7: 132,154,378 P79Q possibly damaging Het
Dhx9 T A 1: 153,465,001 N631I probably benign Het
Dmxl1 T C 18: 49,893,461 S1879P probably damaging Het
Dnhd1 T A 7: 105,651,624 F63I probably benign Het
Dok7 A G 5: 35,066,522 N98S probably damaging Het
Fgd2 A G 17: 29,376,912 T515A probably benign Het
Fmo1 T C 1: 162,836,135 D275G probably benign Het
Gm5796 A G 14: 4,034,759 Y90C probably damaging Het
H60b C A 10: 22,285,738 H42N possibly damaging Het
Hipk2 A G 6: 38,703,634 S924P probably benign Het
Hpf1 C A 8: 60,905,579 S27* probably null Het
Idua T G 5: 108,681,522 D443E probably benign Het
Lamc2 C T 1: 153,133,611 G816D possibly damaging Het
Lgi3 T A 14: 70,531,111 V16E unknown Het
Lpar1 T A 4: 58,486,795 M159L probably benign Het
Magi2 A G 5: 20,550,282 D618G possibly damaging Het
Man2b2 C G 5: 36,810,314 Q903H probably benign Het
March7 A T 2: 60,234,990 K537* probably null Het
Mcoln1 T C 8: 3,505,873 F56S probably damaging Het
Myh7 C G 14: 54,988,801 D461H probably damaging Het
Myo1b A T 1: 51,793,677 M383K probably damaging Het
Olfr160 T C 9: 37,712,133 I49V probably damaging Het
Olfr161 T C 16: 3,592,431 F12L probably damaging Het
Olfr360 A T 2: 37,068,904 T200S probably damaging Het
Pars2 T A 4: 106,654,079 Y353N probably damaging Het
Pcdha8 A C 18: 36,992,684 D73A possibly damaging Het
Pcdhga8 C T 18: 37,727,049 T386M possibly damaging Het
Pdzd2 G T 15: 12,407,336 T346N probably damaging Het
Pik3c2b A G 1: 133,085,611 Q781R probably damaging Het
Pp2d1 T A 17: 53,508,290 T469S possibly damaging Het
Sectm1a G A 11: 121,068,805 L166F probably damaging Het
Sgms1 T A 19: 32,142,769 M246L probably benign Het
Shroom3 G A 5: 92,950,947 G1429S probably benign Het
Snx17 T A 5: 31,195,460 F101Y probably damaging Het
Sowahb C T 5: 93,043,381 S493N probably benign Het
Spc25 T A 2: 69,206,137 R7S unknown Het
Sult2b1 A G 7: 45,730,196 I308T probably benign Het
Tkt A G 14: 30,558,806 N65D probably benign Het
Ttc5 A T 14: 50,773,312 S221T probably benign Het
Ubr5 G A 15: 37,979,832 A2434V probably null Het
Wipf1 A C 2: 73,444,461 S55R probably damaging Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,815,240 probably benign Het
Zfp362 A T 4: 128,777,410 H313Q probably benign Het
Zfy2 T A Y: 2,121,420 I158F probably benign Het
Other mutations in Zdbf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Zdbf2 APN 1 63306514 missense possibly damaging 0.92
IGL00796:Zdbf2 APN 1 63307205 missense probably benign 0.04
IGL00801:Zdbf2 APN 1 63303038 missense possibly damaging 0.66
IGL02803:Zdbf2 APN 1 63303077 missense possibly damaging 0.46
R0143:Zdbf2 UTSW 1 63308074 missense probably benign 0.01
R0147:Zdbf2 UTSW 1 63304006 nonsense probably null
R0148:Zdbf2 UTSW 1 63304006 nonsense probably null
R0433:Zdbf2 UTSW 1 63306143 missense possibly damaging 0.46
R0502:Zdbf2 UTSW 1 63305290 missense possibly damaging 0.66
R0645:Zdbf2 UTSW 1 63304950 missense possibly damaging 0.81
R0765:Zdbf2 UTSW 1 63305723 missense possibly damaging 0.46
R1068:Zdbf2 UTSW 1 63303430 missense possibly damaging 0.94
R1216:Zdbf2 UTSW 1 63303002 missense possibly damaging 0.83
R1235:Zdbf2 UTSW 1 63309073 missense possibly damaging 0.66
R1352:Zdbf2 UTSW 1 63303053 missense probably damaging 0.96
R1402:Zdbf2 UTSW 1 63303627 missense possibly damaging 0.46
R1402:Zdbf2 UTSW 1 63303627 missense possibly damaging 0.46
R1435:Zdbf2 UTSW 1 63303040 missense possibly damaging 0.66
R1562:Zdbf2 UTSW 1 63303588 missense possibly damaging 0.83
R1624:Zdbf2 UTSW 1 63303859 missense possibly damaging 0.66
R1635:Zdbf2 UTSW 1 63304334 missense possibly damaging 0.92
R1644:Zdbf2 UTSW 1 63308972 missense possibly damaging 0.66
R1662:Zdbf2 UTSW 1 63304249 nonsense probably null
R1700:Zdbf2 UTSW 1 63302741 missense unknown
R1720:Zdbf2 UTSW 1 63303277 missense possibly damaging 0.46
R1853:Zdbf2 UTSW 1 63305542 frame shift probably null
R1854:Zdbf2 UTSW 1 63305542 frame shift probably null
R1973:Zdbf2 UTSW 1 63309701 missense unknown
R2336:Zdbf2 UTSW 1 63303464 missense probably benign 0.00
R2428:Zdbf2 UTSW 1 63305615 missense probably benign 0.04
R3010:Zdbf2 UTSW 1 63303065 missense possibly damaging 0.92
R3034:Zdbf2 UTSW 1 63304205 missense probably damaging 0.96
R3079:Zdbf2 UTSW 1 63307477 missense probably benign 0.05
R3196:Zdbf2 UTSW 1 63308420 missense possibly damaging 0.46
R3711:Zdbf2 UTSW 1 63308671 missense possibly damaging 0.83
R3845:Zdbf2 UTSW 1 63308324 missense possibly damaging 0.66
R4093:Zdbf2 UTSW 1 63309781 missense possibly damaging 0.83
R4250:Zdbf2 UTSW 1 63302861 missense possibly damaging 0.46
R4592:Zdbf2 UTSW 1 63306591 missense possibly damaging 0.82
R4721:Zdbf2 UTSW 1 63308792 missense possibly damaging 0.46
R4779:Zdbf2 UTSW 1 63303238 missense possibly damaging 0.66
R4928:Zdbf2 UTSW 1 63308814 missense possibly damaging 0.81
R4943:Zdbf2 UTSW 1 63302914 missense possibly damaging 0.92
R5025:Zdbf2 UTSW 1 63303650 missense possibly damaging 0.82
R5095:Zdbf2 UTSW 1 63309073 missense possibly damaging 0.66
R5149:Zdbf2 UTSW 1 63304903 missense possibly damaging 0.83
R5326:Zdbf2 UTSW 1 63304411 missense possibly damaging 0.66
R5341:Zdbf2 UTSW 1 63307933 missense probably benign 0.27
R5511:Zdbf2 UTSW 1 63305677 missense probably benign 0.03
R5809:Zdbf2 UTSW 1 63305876 missense possibly damaging 0.90
R5902:Zdbf2 UTSW 1 63306526 missense possibly damaging 0.83
R6162:Zdbf2 UTSW 1 63280818 start gained probably benign
R6245:Zdbf2 UTSW 1 63304433 missense possibly damaging 0.46
R6332:Zdbf2 UTSW 1 63307822 missense possibly damaging 0.66
R6361:Zdbf2 UTSW 1 63303321 missense possibly damaging 0.66
R6489:Zdbf2 UTSW 1 63307478 missense possibly damaging 0.46
R6517:Zdbf2 UTSW 1 63305520 missense possibly damaging 0.81
R6624:Zdbf2 UTSW 1 63303914 missense possibly damaging 0.46
R6643:Zdbf2 UTSW 1 63304508 missense possibly damaging 0.82
R6786:Zdbf2 UTSW 1 63304520 missense possibly damaging 0.46
R6808:Zdbf2 UTSW 1 63308528 missense possibly damaging 0.66
R6896:Zdbf2 UTSW 1 63308872 missense probably damaging 0.98
R6997:Zdbf2 UTSW 1 63290766 missense probably benign 0.09
R7011:Zdbf2 UTSW 1 63306766 missense possibly damaging 0.66
R7058:Zdbf2 UTSW 1 63307404 missense possibly damaging 0.66
R7066:Zdbf2 UTSW 1 63307559 missense probably benign
R7177:Zdbf2 UTSW 1 63294961 missense possibly damaging 0.94
R7184:Zdbf2 UTSW 1 63306505 missense possibly damaging 0.92
R7273:Zdbf2 UTSW 1 63303404 missense possibly damaging 0.90
R7387:Zdbf2 UTSW 1 63304039 missense possibly damaging 0.46
R7468:Zdbf2 UTSW 1 63307510 missense probably benign
R7695:Zdbf2 UTSW 1 63307370 missense possibly damaging 0.83
R7735:Zdbf2 UTSW 1 63304105 missense possibly damaging 0.66
R7736:Zdbf2 UTSW 1 63308007 nonsense probably null
R7759:Zdbf2 UTSW 1 63308376 missense possibly damaging 0.46
R7796:Zdbf2 UTSW 1 63303424 missense possibly damaging 0.90
R7908:Zdbf2 UTSW 1 63306827 missense possibly damaging 0.46
R7989:Zdbf2 UTSW 1 63306827 missense possibly damaging 0.46
RF021:Zdbf2 UTSW 1 63302652 missense possibly damaging 0.82
X0018:Zdbf2 UTSW 1 63305351 missense possibly damaging 0.92
X0027:Zdbf2 UTSW 1 63308007 nonsense probably null
X0057:Zdbf2 UTSW 1 63305390 missense possibly damaging 0.66
X0063:Zdbf2 UTSW 1 63305537 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TGTAACTCTGTTAATTCAAAGCCCG -3'
(R):5'- TCTTTTGGGTCAGCATGGCC -3'

Sequencing Primer
(F):5'- TTCAAAGCCCGGATGTTCTGAAG -3'
(R):5'- CCTCTTTCAAAGCAGCTGGTTGAG -3'
Posted On2019-11-12