Mutagenetix > Incidental Mutation

Incidental Mutation 'R7712:Pik3c2b'

594654

Institutional Source

Beutler Lab

Gene Symbol

Pik3c2b

Ensembl Gene

ENSMUSG00000026447

Gene Name

phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 beta

Synonyms

C330011J12Rik, PI3K-C2beta

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.251) question?

Stock #

R7712 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

133045667-133108687 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 133085611 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Arginine at position 781 (Q781R)

Ref Sequence

ENSEMBL: ENSMUSP00000076911 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077730]

AlphaFold

E9QAN8

Predicted Effect

probably damaging
Transcript: ENSMUST00000077730
AA Change: Q781R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000076911
Gene: ENSMUSG00000026447
AA Change: Q781R

Domain	Start	End	E-Value	Type
low complexity region	155	160	N/A	INTRINSIC
low complexity region	168	183	N/A	INTRINSIC
PI3K_rbd	363	465	2.15e-19	SMART
PI3K_C2	618	726	6.17e-29	SMART
PI3Ka	804	990	1.66e-84	SMART
PI3Kc	1078	1340	3.45e-132	SMART
PX	1364	1476	9.44e-27	SMART
low complexity region	1481	1492	N/A	INTRINSIC
C2	1517	1622	1.82e-18	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling pathways involved in cell proliferation, oncogenic transformation, cell survival, cell migration, and intracellular protein trafficking. This protein contains a lipid kinase catalytic domain as well as a C-terminal C2 domain, a characteristic of class II PI3-kinases. C2 domains act as calcium-dependent phospholipid binding motifs that mediate translocation of proteins to membranes, and may also mediate protein-protein interactions. The PI3-kinase activity of this protein is sensitive to low nanomolar levels of the inhibitor wortmanin. The C2 domain of this protein was shown to bind phospholipids but not Ca2+, which suggests that this enzyme may function in a calcium-independent manner. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal epidermal growth, differentiation and function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acacb	A	C	5: 114,165,738	D74A	probably benign	Het
Alox15	T	C	11: 70,350,253		probably null	Het
Ano5	A	G	7: 51,573,057	T455A	probably benign	Het
Ano5	T	G	7: 51,590,655	I827S	probably damaging	Het
Arid1a	G	A	4: 133,752,611	A334V	probably benign	Het
Atp13a4	A	G	16: 29,459,487	C298R		Het
Atp4a	T	A	7: 30,715,553	S256T	probably damaging	Het
Atp6v1c1	G	A	15: 38,686,805	V215I	probably benign	Het
Bbs9	T	A	9: 22,670,813	F600L	probably benign	Het
Bmp8b	A	T	4: 123,124,464	Y376F	possibly damaging	Het
Cacna2d1	A	T	5: 16,362,349	D986V	probably damaging	Het
Ccdc162	A	G	10: 41,627,227	F973S	possibly damaging	Het
Ccdc177	G	A	12: 80,757,938	Q521*	probably null	Het
Cd209b	T	A	8: 3,923,299	E158D	possibly damaging	Het
Cdk14	G	A	5: 5,380,061	T22I	possibly damaging	Het
Chl1	A	T	6: 103,711,102	I968F	possibly damaging	Het
Cnot7	T	C	8: 40,494,081	Y255C	probably damaging	Het
Col4a2	T	A	8: 11,425,376	L600H	probably benign	Het
Cpne7	C	A	8: 123,124,181	L129M	probably damaging	Het
Cpxm2	G	T	7: 132,154,378	P79Q	possibly damaging	Het
Dhx9	T	A	1: 153,465,001	N631I	probably benign	Het
Dmxl1	T	C	18: 49,893,461	S1879P	probably damaging	Het
Dnhd1	T	A	7: 105,651,624	F63I	probably benign	Het
Dok7	A	G	5: 35,066,522	N98S	probably damaging	Het
Fgd2	A	G	17: 29,376,912	T515A	probably benign	Het
Fmo1	T	C	1: 162,836,135	D275G	probably benign	Het
Gm5796	A	G	14: 4,034,759	Y90C	probably damaging	Het
H60b	C	A	10: 22,285,738	H42N	possibly damaging	Het
Hipk2	A	G	6: 38,703,634	S924P	probably benign	Het
Hpf1	C	A	8: 60,905,579	S27*	probably null	Het
Idua	T	G	5: 108,681,522	D443E	probably benign	Het
Lamc2	C	T	1: 153,133,611	G816D	possibly damaging	Het
Lgi3	T	A	14: 70,531,111	V16E	unknown	Het
Lpar1	T	A	4: 58,486,795	M159L	probably benign	Het
Magi2	A	G	5: 20,550,282	D618G	possibly damaging	Het
Man2b2	C	G	5: 36,810,314	Q903H	probably benign	Het
March7	A	T	2: 60,234,990	K537*	probably null	Het
Mcoln1	T	C	8: 3,505,873	F56S	probably damaging	Het
Myh7	C	G	14: 54,988,801	D461H	probably damaging	Het
Myo1b	A	T	1: 51,793,677	M383K	probably damaging	Het
Olfr160	T	C	9: 37,712,133	I49V	probably damaging	Het
Olfr161	T	C	16: 3,592,431	F12L	probably damaging	Het
Olfr360	A	T	2: 37,068,904	T200S	probably damaging	Het
Pars2	T	A	4: 106,654,079	Y353N	probably damaging	Het
Pcdha8	A	C	18: 36,992,684	D73A	possibly damaging	Het
Pcdhga8	C	T	18: 37,727,049	T386M	possibly damaging	Het
Pdzd2	G	T	15: 12,407,336	T346N	probably damaging	Het
Pp2d1	T	A	17: 53,508,290	T469S	possibly damaging	Het
Sectm1a	G	A	11: 121,068,805	L166F	probably damaging	Het
Sgms1	T	A	19: 32,142,769	M246L	probably benign	Het
Shroom3	G	A	5: 92,950,947	G1429S	probably benign	Het
Snx17	T	A	5: 31,195,460	F101Y	probably damaging	Het
Sowahb	C	T	5: 93,043,381	S493N	probably benign	Het
Spc25	T	A	2: 69,206,137	R7S	unknown	Het
Sult2b1	A	G	7: 45,730,196	I308T	probably benign	Het
Tkt	A	G	14: 30,558,806	N65D	probably benign	Het
Ttc5	A	T	14: 50,773,312	S221T	probably benign	Het
Ubr5	G	A	15: 37,979,832	A2434V	probably null	Het
Wipf1	A	C	2: 73,444,461	S55R	probably damaging	Het
Zdbf2	T	C	1: 63,305,371	S970P	possibly damaging	Het
Zfp354c	TCACACTCGGCACA	TCACA	11: 50,815,240		probably benign	Het
Zfp362	A	T	4: 128,777,410	H313Q	probably benign	Het
Zfy2	T	A	Y: 2,121,420	I158F	probably benign	Het

Other mutations in Pik3c2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01086:Pik3c2b	APN	1	133091618	missense	probably damaging	0.98
IGL01288:Pik3c2b	APN	1	133094805	missense	probably damaging	0.96
IGL01313:Pik3c2b	APN	1	133071631	nonsense	probably null
IGL01367:Pik3c2b	APN	1	133105988	missense	probably benign	0.02
IGL02379:Pik3c2b	APN	1	133094791	missense	probably damaging	1.00
IGL02638:Pik3c2b	APN	1	133077318	splice site	probably benign
IGL02728:Pik3c2b	APN	1	133092327	missense	probably benign	0.09
IGL02992:Pik3c2b	APN	1	133066980	nonsense	probably null
IGL03121:Pik3c2b	APN	1	133079745	missense	probably benign	0.00
R0453:Pik3c2b	UTSW	1	133077396	missense	probably damaging	1.00
R0518:Pik3c2b	UTSW	1	133105992	missense	probably damaging	1.00
R0616:Pik3c2b	UTSW	1	133100831	missense	probably damaging	1.00
R0659:Pik3c2b	UTSW	1	133071200	missense	probably damaging	0.99
R1542:Pik3c2b	UTSW	1	133090034	missense	probably damaging	1.00
R1716:Pik3c2b	UTSW	1	133094826	missense	probably damaging	1.00
R1728:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1729:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1730:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1739:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1762:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1783:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1784:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1785:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1816:Pik3c2b	UTSW	1	133101370	missense	probably benign	0.00
R1897:Pik3c2b	UTSW	1	133066916	missense	possibly damaging	0.57
R2006:Pik3c2b	UTSW	1	133066544	missense	probably damaging	1.00
R2067:Pik3c2b	UTSW	1	133099611	missense	probably damaging	1.00
R2271:Pik3c2b	UTSW	1	133103428	missense	probably benign
R2294:Pik3c2b	UTSW	1	133066775	missense	probably damaging	1.00
R2320:Pik3c2b	UTSW	1	133103413	missense	probably damaging	1.00
R4735:Pik3c2b	UTSW	1	133067049	missense	probably benign	0.25
R4926:Pik3c2b	UTSW	1	133099626	nonsense	probably null
R4948:Pik3c2b	UTSW	1	133099715	critical splice donor site	probably null
R4997:Pik3c2b	UTSW	1	133105081	missense	probably damaging	1.00
R5304:Pik3c2b	UTSW	1	133070408	missense	possibly damaging	0.50
R5461:Pik3c2b	UTSW	1	133099702	missense	possibly damaging	0.66
R5722:Pik3c2b	UTSW	1	133103836	missense	probably damaging	1.00
R5971:Pik3c2b	UTSW	1	133074627	splice site	probably null
R5980:Pik3c2b	UTSW	1	133088308	missense	probably benign	0.43
R6036:Pik3c2b	UTSW	1	133090713	missense	possibly damaging	0.95
R6138:Pik3c2b	UTSW	1	133074627	splice site	probably null
R6223:Pik3c2b	UTSW	1	133070357	missense	probably damaging	1.00
R6273:Pik3c2b	UTSW	1	133066711	missense	probably benign	0.02
R6742:Pik3c2b	UTSW	1	133075821	missense	probably benign
R6954:Pik3c2b	UTSW	1	133066303	missense	possibly damaging	0.50
R6998:Pik3c2b	UTSW	1	133102372	missense	probably benign	0.23
R7103:Pik3c2b	UTSW	1	133105974	missense	probably damaging	1.00
R7133:Pik3c2b	UTSW	1	133090234	missense	possibly damaging	0.73
R7161:Pik3c2b	UTSW	1	133106112	missense	probably damaging	0.98
R7183:Pik3c2b	UTSW	1	133066465	missense	probably benign	0.00
R7193:Pik3c2b	UTSW	1	133079774	missense	probably benign	0.00
R7252:Pik3c2b	UTSW	1	133094734	missense	probably benign	0.19
R7263:Pik3c2b	UTSW	1	133090202	missense	probably damaging	0.98
R7404:Pik3c2b	UTSW	1	133090706	missense	probably damaging	1.00
R7709:Pik3c2b	UTSW	1	133079841	critical splice donor site	probably null
R7823:Pik3c2b	UTSW	1	133102305	missense	probably damaging	1.00
R7831:Pik3c2b	UTSW	1	133071242	missense	possibly damaging	0.94
R7913:Pik3c2b	UTSW	1	133090061	critical splice donor site	probably null
R7916:Pik3c2b	UTSW	1	133100904	missense	probably benign	0.30
R7960:Pik3c2b	UTSW	1	133103849	missense	probably damaging	1.00
R7981:Pik3c2b	UTSW	1	133075809	critical splice acceptor site	probably null
R8346:Pik3c2b	UTSW	1	133090246	missense	probably damaging	0.97
R8938:Pik3c2b	UTSW	1	133088330	missense	probably benign	0.19
R8997:Pik3c2b	UTSW	1	133090779	missense	possibly damaging	0.83
R9416:Pik3c2b	UTSW	1	133077449	missense	probably damaging	1.00
R9598:Pik3c2b	UTSW	1	133084987	critical splice donor site	probably null
R9621:Pik3c2b	UTSW	1	133071607	missense	probably damaging	1.00
R9742:Pik3c2b	UTSW	1	133094749	missense	probably damaging	1.00
R9776:Pik3c2b	UTSW	1	133090850	missense	possibly damaging	0.64
R9786:Pik3c2b	UTSW	1	133091600	missense	possibly damaging	0.94
U15987:Pik3c2b	UTSW	1	133074627	splice site	probably null
X0060:Pik3c2b	UTSW	1	133084936	missense	probably benign	0.18
Z1176:Pik3c2b	UTSW	1	133066553	missense	probably damaging	1.00
Z1176:Pik3c2b	UTSW	1	133099686	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TGTGGCCTCTGGGGATAATC -3'
(R):5'- CCAGCTGGATCTGACCTAGAAAC -3'

Sequencing Primer
(F):5'- CCTCTGGGGATAATCCAAGGGAC -3'
(R):5'- GATCTGACCTAGAAACATGAGGTCTC -3'

Posted On

2019-11-12