Incidental Mutation 'R7712:Pik3c2b'
ID 594654
Institutional Source Beutler Lab
Gene Symbol Pik3c2b
Ensembl Gene ENSMUSG00000026447
Gene Name phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 beta
Synonyms PI3K-C2beta, C330011J12Rik
MMRRC Submission 045770-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.253) question?
Stock # R7712 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 132973410-133036429 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 133013349 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Arginine at position 781 (Q781R)
Ref Sequence ENSEMBL: ENSMUSP00000076911 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077730]
AlphaFold E9QAN8
Predicted Effect probably damaging
Transcript: ENSMUST00000077730
AA Change: Q781R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000076911
Gene: ENSMUSG00000026447
AA Change: Q781R

DomainStartEndE-ValueType
low complexity region 155 160 N/A INTRINSIC
low complexity region 168 183 N/A INTRINSIC
PI3K_rbd 363 465 2.15e-19 SMART
PI3K_C2 618 726 6.17e-29 SMART
PI3Ka 804 990 1.66e-84 SMART
PI3Kc 1078 1340 3.45e-132 SMART
PX 1364 1476 9.44e-27 SMART
low complexity region 1481 1492 N/A INTRINSIC
C2 1517 1622 1.82e-18 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling pathways involved in cell proliferation, oncogenic transformation, cell survival, cell migration, and intracellular protein trafficking. This protein contains a lipid kinase catalytic domain as well as a C-terminal C2 domain, a characteristic of class II PI3-kinases. C2 domains act as calcium-dependent phospholipid binding motifs that mediate translocation of proteins to membranes, and may also mediate protein-protein interactions. The PI3-kinase activity of this protein is sensitive to low nanomolar levels of the inhibitor wortmanin. The C2 domain of this protein was shown to bind phospholipids but not Ca2+, which suggests that this enzyme may function in a calcium-independent manner. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal epidermal growth, differentiation and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb A C 5: 114,303,799 (GRCm39) D74A probably benign Het
Alox15 T C 11: 70,241,079 (GRCm39) probably null Het
Ano5 A G 7: 51,222,805 (GRCm39) T455A probably benign Het
Ano5 T G 7: 51,240,403 (GRCm39) I827S probably damaging Het
Arid1a G A 4: 133,479,922 (GRCm39) A334V probably benign Het
Atp13a4 A G 16: 29,278,305 (GRCm39) C298R Het
Atp4a T A 7: 30,414,978 (GRCm39) S256T probably damaging Het
Atp6v1c1 G A 15: 38,687,049 (GRCm39) V215I probably benign Het
Bbs9 T A 9: 22,582,109 (GRCm39) F600L probably benign Het
Bmp8b A T 4: 123,018,257 (GRCm39) Y376F possibly damaging Het
Cacna2d1 A T 5: 16,567,347 (GRCm39) D986V probably damaging Het
Ccdc162 A G 10: 41,503,223 (GRCm39) F973S possibly damaging Het
Ccdc177 G A 12: 80,804,712 (GRCm39) Q521* probably null Het
Cd209b T A 8: 3,973,299 (GRCm39) E158D possibly damaging Het
Cdk14 G A 5: 5,430,061 (GRCm39) T22I possibly damaging Het
Chl1 A T 6: 103,688,063 (GRCm39) I968F possibly damaging Het
Cnot7 T C 8: 40,947,122 (GRCm39) Y255C probably damaging Het
Col4a2 T A 8: 11,475,376 (GRCm39) L600H probably benign Het
Cpne7 C A 8: 123,850,920 (GRCm39) L129M probably damaging Het
Cpxm2 G T 7: 131,756,107 (GRCm39) P79Q possibly damaging Het
Dhx9 T A 1: 153,340,747 (GRCm39) N631I probably benign Het
Dmxl1 T C 18: 50,026,528 (GRCm39) S1879P probably damaging Het
Dnhd1 T A 7: 105,300,831 (GRCm39) F63I probably benign Het
Dok7 A G 5: 35,223,866 (GRCm39) N98S probably damaging Het
Fgd2 A G 17: 29,595,886 (GRCm39) T515A probably benign Het
Fmo1 T C 1: 162,663,704 (GRCm39) D275G probably benign Het
Gm5796 A G 14: 15,379,960 (GRCm39) Y90C probably damaging Het
H60b C A 10: 22,161,637 (GRCm39) H42N possibly damaging Het
Hipk2 A G 6: 38,680,569 (GRCm39) S924P probably benign Het
Hpf1 C A 8: 61,358,613 (GRCm39) S27* probably null Het
Idua T G 5: 108,829,388 (GRCm39) D443E probably benign Het
Lamc2 C T 1: 153,009,357 (GRCm39) G816D possibly damaging Het
Lgi3 T A 14: 70,768,551 (GRCm39) V16E unknown Het
Lpar1 T A 4: 58,486,795 (GRCm39) M159L probably benign Het
Magi2 A G 5: 20,755,280 (GRCm39) D618G possibly damaging Het
Man2b2 C G 5: 36,967,658 (GRCm39) Q903H probably benign Het
Marchf7 A T 2: 60,065,334 (GRCm39) K537* probably null Het
Mcoln1 T C 8: 3,555,873 (GRCm39) F56S probably damaging Het
Myh7 C G 14: 55,226,258 (GRCm39) D461H probably damaging Het
Myo1b A T 1: 51,832,836 (GRCm39) M383K probably damaging Het
Or12k7 A T 2: 36,958,916 (GRCm39) T200S probably damaging Het
Or1f19 T C 16: 3,410,295 (GRCm39) F12L probably damaging Het
Or8a1b T C 9: 37,623,429 (GRCm39) I49V probably damaging Het
Pars2 T A 4: 106,511,276 (GRCm39) Y353N probably damaging Het
Pcdha8 A C 18: 37,125,737 (GRCm39) D73A possibly damaging Het
Pcdhga8 C T 18: 37,860,102 (GRCm39) T386M possibly damaging Het
Pdzd2 G T 15: 12,407,422 (GRCm39) T346N probably damaging Het
Pp2d1 T A 17: 53,815,318 (GRCm39) T469S possibly damaging Het
Sectm1a G A 11: 120,959,631 (GRCm39) L166F probably damaging Het
Sgms1 T A 19: 32,120,169 (GRCm39) M246L probably benign Het
Shroom3 G A 5: 93,098,806 (GRCm39) G1429S probably benign Het
Snx17 T A 5: 31,352,804 (GRCm39) F101Y probably damaging Het
Sowahb C T 5: 93,191,240 (GRCm39) S493N probably benign Het
Spc25 T A 2: 69,036,481 (GRCm39) R7S unknown Het
Sult2b1 A G 7: 45,379,620 (GRCm39) I308T probably benign Het
Tkt A G 14: 30,280,763 (GRCm39) N65D probably benign Het
Ttc5 A T 14: 51,010,769 (GRCm39) S221T probably benign Het
Ubr5 G A 15: 37,980,076 (GRCm39) A2434V probably null Het
Wipf1 A C 2: 73,274,805 (GRCm39) S55R probably damaging Het
Zdbf2 T C 1: 63,344,530 (GRCm39) S970P possibly damaging Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,706,067 (GRCm39) probably benign Het
Zfp362 A T 4: 128,671,203 (GRCm39) H313Q probably benign Het
Zfy2 T A Y: 2,121,420 (GRCm39) I158F probably benign Het
Other mutations in Pik3c2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01086:Pik3c2b APN 1 133,019,356 (GRCm39) missense probably damaging 0.98
IGL01288:Pik3c2b APN 1 133,022,543 (GRCm39) missense probably damaging 0.96
IGL01313:Pik3c2b APN 1 132,999,369 (GRCm39) nonsense probably null
IGL01367:Pik3c2b APN 1 133,033,726 (GRCm39) missense probably benign 0.02
IGL02379:Pik3c2b APN 1 133,022,529 (GRCm39) missense probably damaging 1.00
IGL02638:Pik3c2b APN 1 133,005,056 (GRCm39) splice site probably benign
IGL02728:Pik3c2b APN 1 133,020,065 (GRCm39) missense probably benign 0.09
IGL02992:Pik3c2b APN 1 132,994,718 (GRCm39) nonsense probably null
IGL03121:Pik3c2b APN 1 133,007,483 (GRCm39) missense probably benign 0.00
R0453:Pik3c2b UTSW 1 133,005,134 (GRCm39) missense probably damaging 1.00
R0518:Pik3c2b UTSW 1 133,033,730 (GRCm39) missense probably damaging 1.00
R0616:Pik3c2b UTSW 1 133,028,569 (GRCm39) missense probably damaging 1.00
R0659:Pik3c2b UTSW 1 132,998,938 (GRCm39) missense probably damaging 0.99
R1542:Pik3c2b UTSW 1 133,017,772 (GRCm39) missense probably damaging 1.00
R1716:Pik3c2b UTSW 1 133,022,564 (GRCm39) missense probably damaging 1.00
R1728:Pik3c2b UTSW 1 132,994,365 (GRCm39) missense probably benign 0.00
R1729:Pik3c2b UTSW 1 132,994,365 (GRCm39) missense probably benign 0.00
R1730:Pik3c2b UTSW 1 132,994,365 (GRCm39) missense probably benign 0.00
R1739:Pik3c2b UTSW 1 132,994,365 (GRCm39) missense probably benign 0.00
R1762:Pik3c2b UTSW 1 132,994,365 (GRCm39) missense probably benign 0.00
R1783:Pik3c2b UTSW 1 132,994,365 (GRCm39) missense probably benign 0.00
R1784:Pik3c2b UTSW 1 132,994,365 (GRCm39) missense probably benign 0.00
R1785:Pik3c2b UTSW 1 132,994,365 (GRCm39) missense probably benign 0.00
R1816:Pik3c2b UTSW 1 133,029,108 (GRCm39) missense probably benign 0.00
R1897:Pik3c2b UTSW 1 132,994,654 (GRCm39) missense possibly damaging 0.57
R2006:Pik3c2b UTSW 1 132,994,282 (GRCm39) missense probably damaging 1.00
R2067:Pik3c2b UTSW 1 133,027,349 (GRCm39) missense probably damaging 1.00
R2271:Pik3c2b UTSW 1 133,031,166 (GRCm39) missense probably benign
R2294:Pik3c2b UTSW 1 132,994,513 (GRCm39) missense probably damaging 1.00
R2320:Pik3c2b UTSW 1 133,031,151 (GRCm39) missense probably damaging 1.00
R4735:Pik3c2b UTSW 1 132,994,787 (GRCm39) missense probably benign 0.25
R4926:Pik3c2b UTSW 1 133,027,364 (GRCm39) nonsense probably null
R4948:Pik3c2b UTSW 1 133,027,453 (GRCm39) critical splice donor site probably null
R4997:Pik3c2b UTSW 1 133,032,819 (GRCm39) missense probably damaging 1.00
R5304:Pik3c2b UTSW 1 132,998,146 (GRCm39) missense possibly damaging 0.50
R5461:Pik3c2b UTSW 1 133,027,440 (GRCm39) missense possibly damaging 0.66
R5722:Pik3c2b UTSW 1 133,031,574 (GRCm39) missense probably damaging 1.00
R5971:Pik3c2b UTSW 1 133,002,365 (GRCm39) splice site probably null
R5980:Pik3c2b UTSW 1 133,016,046 (GRCm39) missense probably benign 0.43
R6036:Pik3c2b UTSW 1 133,018,451 (GRCm39) missense possibly damaging 0.95
R6138:Pik3c2b UTSW 1 133,002,365 (GRCm39) splice site probably null
R6223:Pik3c2b UTSW 1 132,998,095 (GRCm39) missense probably damaging 1.00
R6273:Pik3c2b UTSW 1 132,994,449 (GRCm39) missense probably benign 0.02
R6742:Pik3c2b UTSW 1 133,003,559 (GRCm39) missense probably benign
R6954:Pik3c2b UTSW 1 132,994,041 (GRCm39) missense possibly damaging 0.50
R6998:Pik3c2b UTSW 1 133,030,110 (GRCm39) missense probably benign 0.23
R7103:Pik3c2b UTSW 1 133,033,712 (GRCm39) missense probably damaging 1.00
R7133:Pik3c2b UTSW 1 133,017,972 (GRCm39) missense possibly damaging 0.73
R7161:Pik3c2b UTSW 1 133,033,850 (GRCm39) missense probably damaging 0.98
R7183:Pik3c2b UTSW 1 132,994,203 (GRCm39) missense probably benign 0.00
R7193:Pik3c2b UTSW 1 133,007,512 (GRCm39) missense probably benign 0.00
R7252:Pik3c2b UTSW 1 133,022,472 (GRCm39) missense probably benign 0.19
R7263:Pik3c2b UTSW 1 133,017,940 (GRCm39) missense probably damaging 0.98
R7404:Pik3c2b UTSW 1 133,018,444 (GRCm39) missense probably damaging 1.00
R7709:Pik3c2b UTSW 1 133,007,579 (GRCm39) critical splice donor site probably null
R7823:Pik3c2b UTSW 1 133,030,043 (GRCm39) missense probably damaging 1.00
R7831:Pik3c2b UTSW 1 132,998,980 (GRCm39) missense possibly damaging 0.94
R7913:Pik3c2b UTSW 1 133,017,799 (GRCm39) critical splice donor site probably null
R7916:Pik3c2b UTSW 1 133,028,642 (GRCm39) missense probably benign 0.30
R7960:Pik3c2b UTSW 1 133,031,587 (GRCm39) missense probably damaging 1.00
R7981:Pik3c2b UTSW 1 133,003,547 (GRCm39) critical splice acceptor site probably null
R8346:Pik3c2b UTSW 1 133,017,984 (GRCm39) missense probably damaging 0.97
R8938:Pik3c2b UTSW 1 133,016,068 (GRCm39) missense probably benign 0.19
R8997:Pik3c2b UTSW 1 133,018,517 (GRCm39) missense possibly damaging 0.83
R9416:Pik3c2b UTSW 1 133,005,187 (GRCm39) missense probably damaging 1.00
R9598:Pik3c2b UTSW 1 133,012,725 (GRCm39) critical splice donor site probably null
R9621:Pik3c2b UTSW 1 132,999,345 (GRCm39) missense probably damaging 1.00
R9742:Pik3c2b UTSW 1 133,022,487 (GRCm39) missense probably damaging 1.00
R9776:Pik3c2b UTSW 1 133,018,588 (GRCm39) missense possibly damaging 0.64
R9786:Pik3c2b UTSW 1 133,019,338 (GRCm39) missense possibly damaging 0.94
U15987:Pik3c2b UTSW 1 133,002,365 (GRCm39) splice site probably null
X0060:Pik3c2b UTSW 1 133,012,674 (GRCm39) missense probably benign 0.18
Z1176:Pik3c2b UTSW 1 133,027,424 (GRCm39) nonsense probably null
Z1176:Pik3c2b UTSW 1 132,994,291 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGGCCTCTGGGGATAATC -3'
(R):5'- CCAGCTGGATCTGACCTAGAAAC -3'

Sequencing Primer
(F):5'- CCTCTGGGGATAATCCAAGGGAC -3'
(R):5'- GATCTGACCTAGAAACATGAGGTCTC -3'
Posted On 2019-11-12