Incidental Mutation 'R7712:March7'
ID594659
Institutional Source Beutler Lab
Gene Symbol March7
Ensembl Gene ENSMUSG00000026977
Gene Namemembrane-associated ring finger (C3HC4) 7
SynonymsAxot, Gtrgeo17
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.378) question?
Stock #R7712 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location60209887-60250676 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 60234990 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 537 (K537*)
Ref Sequence ENSEMBL: ENSMUSP00000068961 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067542] [ENSMUST00000102747] [ENSMUST00000102748]
Predicted Effect probably null
Transcript: ENSMUST00000067542
AA Change: K537*
SMART Domains Protein: ENSMUSP00000068961
Gene: ENSMUSG00000026977
AA Change: K537*

DomainStartEndE-ValueType
low complexity region 51 65 N/A INTRINSIC
low complexity region 76 85 N/A INTRINSIC
low complexity region 139 152 N/A INTRINSIC
low complexity region 216 234 N/A INTRINSIC
low complexity region 286 305 N/A INTRINSIC
low complexity region 324 338 N/A INTRINSIC
low complexity region 400 414 N/A INTRINSIC
low complexity region 451 463 N/A INTRINSIC
RINGv 553 610 2.11e-21 SMART
Predicted Effect probably null
Transcript: ENSMUST00000102747
AA Change: K537*
SMART Domains Protein: ENSMUSP00000099808
Gene: ENSMUSG00000026977
AA Change: K537*

DomainStartEndE-ValueType
low complexity region 51 65 N/A INTRINSIC
low complexity region 76 85 N/A INTRINSIC
low complexity region 139 152 N/A INTRINSIC
low complexity region 216 234 N/A INTRINSIC
low complexity region 286 305 N/A INTRINSIC
low complexity region 324 338 N/A INTRINSIC
low complexity region 400 414 N/A INTRINSIC
low complexity region 451 463 N/A INTRINSIC
RINGv 553 610 2.11e-21 SMART
Predicted Effect probably null
Transcript: ENSMUST00000102748
AA Change: K537*
SMART Domains Protein: ENSMUSP00000099809
Gene: ENSMUSG00000026977
AA Change: K537*

DomainStartEndE-ValueType
low complexity region 51 65 N/A INTRINSIC
low complexity region 76 85 N/A INTRINSIC
low complexity region 139 152 N/A INTRINSIC
low complexity region 216 234 N/A INTRINSIC
low complexity region 286 305 N/A INTRINSIC
low complexity region 324 338 N/A INTRINSIC
low complexity region 400 414 N/A INTRINSIC
low complexity region 451 463 N/A INTRINSIC
RINGv 553 610 2.11e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142485
SMART Domains Protein: ENSMUSP00000116925
Gene: ENSMUSG00000026977

DomainStartEndE-ValueType
RINGv 15 72 2.11e-21 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MARCH7 is a member of the MARCH family of membrane-bound E3 ubiquitin ligases (EC 6.3.2.19). MARCH proteins add ubiquitin (see MIM 191339) to target lysines in substrate proteins, thereby signaling their vesicular transport between membrane compartments (Bartee et al., 2004 [PubMed 14722266]).[supplied by OMIM, Mar 2010]
PHENOTYPE: Homozygous null mice show premature neural degeneration and defective development of the corpus callosum. Both T cell proliferation and T cell-derived leukaemia inhibitory factor are increased. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb A C 5: 114,165,738 D74A probably benign Het
Alox15 T C 11: 70,350,253 probably null Het
Ano5 A G 7: 51,573,057 T455A probably benign Het
Ano5 T G 7: 51,590,655 I827S probably damaging Het
Arid1a G A 4: 133,752,611 A334V probably benign Het
Atp13a4 A G 16: 29,459,487 C298R Het
Atp4a T A 7: 30,715,553 S256T probably damaging Het
Atp6v1c1 G A 15: 38,686,805 V215I probably benign Het
Bbs9 T A 9: 22,670,813 F600L probably benign Het
Bmp8b A T 4: 123,124,464 Y376F possibly damaging Het
Cacna2d1 A T 5: 16,362,349 D986V probably damaging Het
Ccdc162 A G 10: 41,627,227 F973S possibly damaging Het
Ccdc177 G A 12: 80,757,938 Q521* probably null Het
Cd209b T A 8: 3,923,299 E158D possibly damaging Het
Cdk14 G A 5: 5,380,061 T22I possibly damaging Het
Chl1 A T 6: 103,711,102 I968F possibly damaging Het
Cnot7 T C 8: 40,494,081 Y255C probably damaging Het
Col4a2 T A 8: 11,425,376 L600H probably benign Het
Cpne7 C A 8: 123,124,181 L129M probably damaging Het
Cpxm2 G T 7: 132,154,378 P79Q possibly damaging Het
Dhx9 T A 1: 153,465,001 N631I probably benign Het
Dmxl1 T C 18: 49,893,461 S1879P probably damaging Het
Dnhd1 T A 7: 105,651,624 F63I probably benign Het
Dok7 A G 5: 35,066,522 N98S probably damaging Het
Fgd2 A G 17: 29,376,912 T515A probably benign Het
Fmo1 T C 1: 162,836,135 D275G probably benign Het
Gm5796 A G 14: 4,034,759 Y90C probably damaging Het
H60b C A 10: 22,285,738 H42N possibly damaging Het
Hipk2 A G 6: 38,703,634 S924P probably benign Het
Hpf1 C A 8: 60,905,579 S27* probably null Het
Idua T G 5: 108,681,522 D443E probably benign Het
Lamc2 C T 1: 153,133,611 G816D possibly damaging Het
Lgi3 T A 14: 70,531,111 V16E unknown Het
Lpar1 T A 4: 58,486,795 M159L probably benign Het
Magi2 A G 5: 20,550,282 D618G possibly damaging Het
Man2b2 C G 5: 36,810,314 Q903H probably benign Het
Mcoln1 T C 8: 3,505,873 F56S probably damaging Het
Myh7 C G 14: 54,988,801 D461H probably damaging Het
Myo1b A T 1: 51,793,677 M383K probably damaging Het
Olfr160 T C 9: 37,712,133 I49V probably damaging Het
Olfr161 T C 16: 3,592,431 F12L probably damaging Het
Olfr360 A T 2: 37,068,904 T200S probably damaging Het
Pars2 T A 4: 106,654,079 Y353N probably damaging Het
Pcdha8 A C 18: 36,992,684 D73A possibly damaging Het
Pcdhga8 C T 18: 37,727,049 T386M possibly damaging Het
Pdzd2 G T 15: 12,407,336 T346N probably damaging Het
Pik3c2b A G 1: 133,085,611 Q781R probably damaging Het
Pp2d1 T A 17: 53,508,290 T469S possibly damaging Het
Sectm1a G A 11: 121,068,805 L166F probably damaging Het
Sgms1 T A 19: 32,142,769 M246L probably benign Het
Shroom3 G A 5: 92,950,947 G1429S probably benign Het
Snx17 T A 5: 31,195,460 F101Y probably damaging Het
Sowahb C T 5: 93,043,381 S493N probably benign Het
Spc25 T A 2: 69,206,137 R7S unknown Het
Sult2b1 A G 7: 45,730,196 I308T probably benign Het
Tkt A G 14: 30,558,806 N65D probably benign Het
Ttc5 A T 14: 50,773,312 S221T probably benign Het
Ubr5 G A 15: 37,979,832 A2434V probably null Het
Wipf1 A C 2: 73,444,461 S55R probably damaging Het
Zdbf2 T C 1: 63,305,371 S970P possibly damaging Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,815,240 probably benign Het
Zfp362 A T 4: 128,777,410 H313Q probably benign Het
Zfy2 T A Y: 2,121,420 I158F probably benign Het
Other mutations in March7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01761:March7 APN 2 60234195 missense probably benign 0.01
IGL02001:March7 APN 2 60234891 missense possibly damaging 0.95
IGL02927:March7 APN 2 60236918 missense probably damaging 1.00
PIT4687001:March7 UTSW 2 60232278 missense probably damaging 1.00
R0379:March7 UTSW 2 60234126 missense probably benign 0.00
R1722:March7 UTSW 2 60234182 missense probably damaging 1.00
R1755:March7 UTSW 2 60234921 missense probably benign
R1759:March7 UTSW 2 60234544 missense probably damaging 1.00
R1809:March7 UTSW 2 60232293 missense probably benign 0.16
R2018:March7 UTSW 2 60229040 nonsense probably null
R2226:March7 UTSW 2 60229846 missense probably benign 0.13
R2227:March7 UTSW 2 60229846 missense probably benign 0.13
R2471:March7 UTSW 2 60236900 missense possibly damaging 0.80
R3724:March7 UTSW 2 60229745 missense probably benign 0.10
R4349:March7 UTSW 2 60234195 missense probably benign 0.01
R4667:March7 UTSW 2 60241050 nonsense probably null
R5365:March7 UTSW 2 60233914 missense possibly damaging 0.48
R5524:March7 UTSW 2 60245303 intron probably benign
R5860:March7 UTSW 2 60236843 missense probably damaging 1.00
R5883:March7 UTSW 2 60234442 missense probably damaging 1.00
R5945:March7 UTSW 2 60240987 missense probably damaging 1.00
R5992:March7 UTSW 2 60245220 missense probably benign 0.14
R6937:March7 UTSW 2 60240966 missense probably damaging 1.00
R6944:March7 UTSW 2 60234243 missense probably benign 0.08
R6992:March7 UTSW 2 60229084 critical splice donor site probably null
R7337:March7 UTSW 2 60240845 intron probably null
R7448:March7 UTSW 2 60247514 critical splice donor site probably null
R7577:March7 UTSW 2 60229704 nonsense probably null
R7863:March7 UTSW 2 60241022 missense probably benign 0.35
R7946:March7 UTSW 2 60241022 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- AACAGGGATTCTTCCTGGCTC -3'
(R):5'- TAAGACATGTCAGATTCATCCTTCC -3'

Sequencing Primer
(F):5'- GCTCCTTGTTCCGGTTTGCAG -3'
(R):5'- TGGCCTCGAACTCAGTAATCAG -3'
Posted On2019-11-12