Incidental Mutation 'R7712:Zfp362'
ID 594665
Institutional Source Beutler Lab
Gene Symbol Zfp362
Ensembl Gene ENSMUSG00000028799
Gene Name zinc finger protein 362
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.171) question?
Stock # R7712 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 128773088-128806045 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 128777410 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 313 (H313Q)
Ref Sequence ENSEMBL: ENSMUSP00000065733 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071108] [ENSMUST00000106072] [ENSMUST00000170934]
AlphaFold B1ASA5
Predicted Effect probably benign
Transcript: ENSMUST00000071108
AA Change: H313Q

PolyPhen 2 Score 0.143 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000065733
Gene: ENSMUSG00000028799
AA Change: H313Q

DomainStartEndE-ValueType
low complexity region 1 14 N/A INTRINSIC
low complexity region 128 150 N/A INTRINSIC
low complexity region 200 211 N/A INTRINSIC
ZnF_C2H2 225 247 2.75e-3 SMART
ZnF_C2H2 253 275 1.98e-4 SMART
ZnF_C2H2 281 303 1.38e-3 SMART
ZnF_C2H2 309 333 3.49e-5 SMART
ZnF_C2H2 339 361 1.08e-1 SMART
ZnF_C2H2 369 391 7.26e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106072
AA Change: H313Q

PolyPhen 2 Score 0.143 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000101686
Gene: ENSMUSG00000028799
AA Change: H313Q

DomainStartEndE-ValueType
low complexity region 1 14 N/A INTRINSIC
low complexity region 128 150 N/A INTRINSIC
low complexity region 200 211 N/A INTRINSIC
ZnF_C2H2 225 247 2.75e-3 SMART
ZnF_C2H2 253 275 1.98e-4 SMART
ZnF_C2H2 281 303 1.38e-3 SMART
ZnF_C2H2 309 333 3.49e-5 SMART
ZnF_C2H2 339 361 1.08e-1 SMART
ZnF_C2H2 369 391 7.26e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170934
AA Change: H300Q

PolyPhen 2 Score 0.143 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000128499
Gene: ENSMUSG00000028799
AA Change: H300Q

DomainStartEndE-ValueType
low complexity region 115 137 N/A INTRINSIC
low complexity region 187 198 N/A INTRINSIC
ZnF_C2H2 212 234 2.75e-3 SMART
ZnF_C2H2 240 262 1.98e-4 SMART
ZnF_C2H2 268 290 1.38e-3 SMART
ZnF_C2H2 296 320 3.49e-5 SMART
ZnF_C2H2 326 348 1.08e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb A C 5: 114,165,738 D74A probably benign Het
Alox15 T C 11: 70,350,253 probably null Het
Ano5 A G 7: 51,573,057 T455A probably benign Het
Ano5 T G 7: 51,590,655 I827S probably damaging Het
Arid1a G A 4: 133,752,611 A334V probably benign Het
Atp13a4 A G 16: 29,459,487 C298R Het
Atp4a T A 7: 30,715,553 S256T probably damaging Het
Atp6v1c1 G A 15: 38,686,805 V215I probably benign Het
Bbs9 T A 9: 22,670,813 F600L probably benign Het
Bmp8b A T 4: 123,124,464 Y376F possibly damaging Het
Cacna2d1 A T 5: 16,362,349 D986V probably damaging Het
Ccdc162 A G 10: 41,627,227 F973S possibly damaging Het
Ccdc177 G A 12: 80,757,938 Q521* probably null Het
Cd209b T A 8: 3,923,299 E158D possibly damaging Het
Cdk14 G A 5: 5,380,061 T22I possibly damaging Het
Chl1 A T 6: 103,711,102 I968F possibly damaging Het
Cnot7 T C 8: 40,494,081 Y255C probably damaging Het
Col4a2 T A 8: 11,425,376 L600H probably benign Het
Cpne7 C A 8: 123,124,181 L129M probably damaging Het
Cpxm2 G T 7: 132,154,378 P79Q possibly damaging Het
Dhx9 T A 1: 153,465,001 N631I probably benign Het
Dmxl1 T C 18: 49,893,461 S1879P probably damaging Het
Dnhd1 T A 7: 105,651,624 F63I probably benign Het
Dok7 A G 5: 35,066,522 N98S probably damaging Het
Fgd2 A G 17: 29,376,912 T515A probably benign Het
Fmo1 T C 1: 162,836,135 D275G probably benign Het
Gm5796 A G 14: 4,034,759 Y90C probably damaging Het
H60b C A 10: 22,285,738 H42N possibly damaging Het
Hipk2 A G 6: 38,703,634 S924P probably benign Het
Hpf1 C A 8: 60,905,579 S27* probably null Het
Idua T G 5: 108,681,522 D443E probably benign Het
Lamc2 C T 1: 153,133,611 G816D possibly damaging Het
Lgi3 T A 14: 70,531,111 V16E unknown Het
Lpar1 T A 4: 58,486,795 M159L probably benign Het
Magi2 A G 5: 20,550,282 D618G possibly damaging Het
Man2b2 C G 5: 36,810,314 Q903H probably benign Het
March7 A T 2: 60,234,990 K537* probably null Het
Mcoln1 T C 8: 3,505,873 F56S probably damaging Het
Myh7 C G 14: 54,988,801 D461H probably damaging Het
Myo1b A T 1: 51,793,677 M383K probably damaging Het
Olfr160 T C 9: 37,712,133 I49V probably damaging Het
Olfr161 T C 16: 3,592,431 F12L probably damaging Het
Olfr360 A T 2: 37,068,904 T200S probably damaging Het
Pars2 T A 4: 106,654,079 Y353N probably damaging Het
Pcdha8 A C 18: 36,992,684 D73A possibly damaging Het
Pcdhga8 C T 18: 37,727,049 T386M possibly damaging Het
Pdzd2 G T 15: 12,407,336 T346N probably damaging Het
Pik3c2b A G 1: 133,085,611 Q781R probably damaging Het
Pp2d1 T A 17: 53,508,290 T469S possibly damaging Het
Sectm1a G A 11: 121,068,805 L166F probably damaging Het
Sgms1 T A 19: 32,142,769 M246L probably benign Het
Shroom3 G A 5: 92,950,947 G1429S probably benign Het
Snx17 T A 5: 31,195,460 F101Y probably damaging Het
Sowahb C T 5: 93,043,381 S493N probably benign Het
Spc25 T A 2: 69,206,137 R7S unknown Het
Sult2b1 A G 7: 45,730,196 I308T probably benign Het
Tkt A G 14: 30,558,806 N65D probably benign Het
Ttc5 A T 14: 50,773,312 S221T probably benign Het
Ubr5 G A 15: 37,979,832 A2434V probably null Het
Wipf1 A C 2: 73,444,461 S55R probably damaging Het
Zdbf2 T C 1: 63,305,371 S970P possibly damaging Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,815,240 probably benign Het
Zfy2 T A Y: 2,121,420 I158F probably benign Het
Other mutations in Zfp362
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01667:Zfp362 APN 4 128787109 missense probably damaging 1.00
IGL01939:Zfp362 APN 4 128787053 missense probably benign
trek UTSW 4 128785976 missense probably damaging 1.00
Zax UTSW 4 128790260 missense possibly damaging 0.71
Zebulon UTSW 4 128786015 missense probably damaging 1.00
R1471:Zfp362 UTSW 4 128787200 missense probably benign
R1892:Zfp362 UTSW 4 128790264 missense probably benign 0.17
R1901:Zfp362 UTSW 4 128790276 missense probably damaging 1.00
R2058:Zfp362 UTSW 4 128786987 missense possibly damaging 0.71
R3739:Zfp362 UTSW 4 128786889 splice site probably benign
R6772:Zfp362 UTSW 4 128790260 missense possibly damaging 0.71
R6900:Zfp362 UTSW 4 128786015 missense probably damaging 1.00
R6901:Zfp362 UTSW 4 128786015 missense probably damaging 1.00
R7105:Zfp362 UTSW 4 128774526 missense probably damaging 0.99
R7348:Zfp362 UTSW 4 128777217 missense possibly damaging 0.88
R7629:Zfp362 UTSW 4 128786055 missense probably damaging 1.00
R7763:Zfp362 UTSW 4 128787031 missense probably benign
R8434:Zfp362 UTSW 4 128785976 missense probably damaging 1.00
R8508:Zfp362 UTSW 4 128774606 missense probably damaging 1.00
R9432:Zfp362 UTSW 4 128777187 missense probably damaging 1.00
Z1177:Zfp362 UTSW 4 128774550 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CGCTGGTGAGACTGTAAAGAGC -3'
(R):5'- AACTGTGTTCAGACCAGCCG -3'

Sequencing Primer
(F):5'- CACGGTAAGGGGCTGTG -3'
(R):5'- GGCCTACTCTTGACCACCAGAG -3'
Posted On 2019-11-12