Incidental Mutation 'R7712:Dok7'
ID594671
Institutional Source Beutler Lab
Gene Symbol Dok7
Ensembl Gene ENSMUSG00000044716
Gene Namedocking protein 7
SynonymsDok-7, Oit5, A930013K19Rik, EF-12
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7712 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location35056766-35087839 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 35066522 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 98 (N98S)
Ref Sequence ENSEMBL: ENSMUSP00000059538 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050709] [ENSMUST00000101298] [ENSMUST00000114270] [ENSMUST00000133381]
Predicted Effect probably damaging
Transcript: ENSMUST00000050709
AA Change: N98S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000059538
Gene: ENSMUSG00000044716
AA Change: N98S

DomainStartEndE-ValueType
IRS 73 168 3.15e-26 SMART
low complexity region 212 243 N/A INTRINSIC
low complexity region 279 291 N/A INTRINSIC
low complexity region 306 321 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101298
SMART Domains Protein: ENSMUSP00000098856
Gene: ENSMUSG00000044716

DomainStartEndE-ValueType
Blast:PH 5 49 2e-11 BLAST
PDB:3ML4|D 35 76 4e-20 PDB
low complexity region 105 136 N/A INTRINSIC
low complexity region 172 184 N/A INTRINSIC
low complexity region 199 214 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114270
AA Change: N135S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000109909
Gene: ENSMUSG00000044716
AA Change: N135S

DomainStartEndE-ValueType
PH 5 111 7.9e-3 SMART
IRS 110 205 3.15e-26 SMART
low complexity region 249 280 N/A INTRINSIC
low complexity region 316 328 N/A INTRINSIC
low complexity region 343 358 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133381
SMART Domains Protein: ENSMUSP00000116023
Gene: ENSMUSG00000044716

DomainStartEndE-ValueType
PDB:3ML4|D 1 114 6e-77 PDB
Blast:PH 5 103 8e-65 BLAST
SCOP:d1qqga1 9 104 4e-7 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is essential for neuromuscular synaptogenesis. The protein functions in aneural activation of muscle-specific receptor kinase, which is required for postsynaptic differentiation, and in the subsequent clustering of the acetylcholine receptor in myotubes. This protein can also induce autophosphorylation of muscle-specific receptor kinase. Mutations in this gene are a cause of familial limb-girdle myasthenia autosomal recessive, which is also known as congenital myasthenic syndrome type 1B. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous mutation of this gene results in death shortly after birth, impaired neuromuscular synaptogenesis and akinesia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb A C 5: 114,165,738 D74A probably benign Het
Alox15 T C 11: 70,350,253 probably null Het
Ano5 A G 7: 51,573,057 T455A probably benign Het
Ano5 T G 7: 51,590,655 I827S probably damaging Het
Arid1a G A 4: 133,752,611 A334V probably benign Het
Atp13a4 A G 16: 29,459,487 C298R Het
Atp4a T A 7: 30,715,553 S256T probably damaging Het
Atp6v1c1 G A 15: 38,686,805 V215I probably benign Het
Bbs9 T A 9: 22,670,813 F600L probably benign Het
Bmp8b A T 4: 123,124,464 Y376F possibly damaging Het
Cacna2d1 A T 5: 16,362,349 D986V probably damaging Het
Ccdc162 A G 10: 41,627,227 F973S possibly damaging Het
Ccdc177 G A 12: 80,757,938 Q521* probably null Het
Cd209b T A 8: 3,923,299 E158D possibly damaging Het
Cdk14 G A 5: 5,380,061 T22I possibly damaging Het
Chl1 A T 6: 103,711,102 I968F possibly damaging Het
Cnot7 T C 8: 40,494,081 Y255C probably damaging Het
Col4a2 T A 8: 11,425,376 L600H probably benign Het
Cpne7 C A 8: 123,124,181 L129M probably damaging Het
Cpxm2 G T 7: 132,154,378 P79Q possibly damaging Het
Dhx9 T A 1: 153,465,001 N631I probably benign Het
Dmxl1 T C 18: 49,893,461 S1879P probably damaging Het
Dnhd1 T A 7: 105,651,624 F63I probably benign Het
Fgd2 A G 17: 29,376,912 T515A probably benign Het
Fmo1 T C 1: 162,836,135 D275G probably benign Het
Gm5796 A G 14: 4,034,759 Y90C probably damaging Het
H60b C A 10: 22,285,738 H42N possibly damaging Het
Hipk2 A G 6: 38,703,634 S924P probably benign Het
Hpf1 C A 8: 60,905,579 S27* probably null Het
Idua T G 5: 108,681,522 D443E probably benign Het
Lamc2 C T 1: 153,133,611 G816D possibly damaging Het
Lgi3 T A 14: 70,531,111 V16E unknown Het
Lpar1 T A 4: 58,486,795 M159L probably benign Het
Magi2 A G 5: 20,550,282 D618G possibly damaging Het
Man2b2 C G 5: 36,810,314 Q903H probably benign Het
March7 A T 2: 60,234,990 K537* probably null Het
Mcoln1 T C 8: 3,505,873 F56S probably damaging Het
Myh7 C G 14: 54,988,801 D461H probably damaging Het
Myo1b A T 1: 51,793,677 M383K probably damaging Het
Olfr160 T C 9: 37,712,133 I49V probably damaging Het
Olfr161 T C 16: 3,592,431 F12L probably damaging Het
Olfr360 A T 2: 37,068,904 T200S probably damaging Het
Pars2 T A 4: 106,654,079 Y353N probably damaging Het
Pcdha8 A C 18: 36,992,684 D73A possibly damaging Het
Pcdhga8 C T 18: 37,727,049 T386M possibly damaging Het
Pdzd2 G T 15: 12,407,336 T346N probably damaging Het
Pik3c2b A G 1: 133,085,611 Q781R probably damaging Het
Pp2d1 T A 17: 53,508,290 T469S possibly damaging Het
Sectm1a G A 11: 121,068,805 L166F probably damaging Het
Sgms1 T A 19: 32,142,769 M246L probably benign Het
Shroom3 G A 5: 92,950,947 G1429S probably benign Het
Snx17 T A 5: 31,195,460 F101Y probably damaging Het
Sowahb C T 5: 93,043,381 S493N probably benign Het
Spc25 T A 2: 69,206,137 R7S unknown Het
Sult2b1 A G 7: 45,730,196 I308T probably benign Het
Tkt A G 14: 30,558,806 N65D probably benign Het
Ttc5 A T 14: 50,773,312 S221T probably benign Het
Ubr5 G A 15: 37,979,832 A2434V probably null Het
Wipf1 A C 2: 73,444,461 S55R probably damaging Het
Zdbf2 T C 1: 63,305,371 S970P possibly damaging Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,815,240 probably benign Het
Zfp362 A T 4: 128,777,410 H313Q probably benign Het
Zfy2 T A Y: 2,121,420 I158F probably benign Het
Other mutations in Dok7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01309:Dok7 APN 5 35079568 missense possibly damaging 0.49
P0022:Dok7 UTSW 5 35075411 missense probably damaging 1.00
R0255:Dok7 UTSW 5 35064334 missense probably damaging 1.00
R0462:Dok7 UTSW 5 35066462 missense possibly damaging 0.88
R0536:Dok7 UTSW 5 35066482 missense probably damaging 1.00
R0800:Dok7 UTSW 5 35075289 splice site probably benign
R1533:Dok7 UTSW 5 35064327 splice site probably null
R1659:Dok7 UTSW 5 35079139 missense possibly damaging 0.55
R1772:Dok7 UTSW 5 35086650 missense probably damaging 0.98
R1969:Dok7 UTSW 5 35077266 splice site probably null
R4321:Dok7 UTSW 5 35079797 utr 3 prime probably benign
R5864:Dok7 UTSW 5 35066546 missense probably damaging 1.00
R6047:Dok7 UTSW 5 35079307 missense probably damaging 1.00
R6773:Dok7 UTSW 5 35077184 missense probably damaging 1.00
R7003:Dok7 UTSW 5 35079555 missense probably benign 0.06
R7129:Dok7 UTSW 5 35079048 missense probably damaging 1.00
R7326:Dok7 UTSW 5 35064522 missense probably benign 0.11
R7399:Dok7 UTSW 5 35066471 missense probably damaging 1.00
R7851:Dok7 UTSW 5 35056936 start codon destroyed probably null 0.04
R7934:Dok7 UTSW 5 35056936 start codon destroyed probably null 0.04
Predicted Primers PCR Primer
(F):5'- TGGGAGGAATGTTGCCTCTAC -3'
(R):5'- TGTTGCTTGGGGAAACAGC -3'

Sequencing Primer
(F):5'- GGAGGAATGTTGCCTCTACCCATC -3'
(R):5'- AATGCGTAGGCCCATCAG -3'
Posted On2019-11-12