Incidental Mutation 'R7712:Man2b2'
ID594672
Institutional Source Beutler Lab
Gene Symbol Man2b2
Ensembl Gene ENSMUSG00000029119
Gene Namemannosidase 2, alpha B2
Synonyms135 kDa alpha-D-mannosidase
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7712 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location36806921-36830653 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 36810314 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Histidine at position 903 (Q903H)
Ref Sequence ENSEMBL: ENSMUSP00000031002 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031002]
Predicted Effect probably benign
Transcript: ENSMUST00000031002
AA Change: Q903H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000031002
Gene: ENSMUSG00000029119
AA Change: Q903H

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Glyco_hydro_38 28 351 4e-100 PFAM
Alpha-mann_mid 356 439 3.3e-20 SMART
Pfam:Glyco_hydro_38C 487 1013 2e-98 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000124711
AA Change: A466P
SMART Domains Protein: ENSMUSP00000115495
Gene: ENSMUSG00000029119
AA Change: A466P

DomainStartEndE-ValueType
Pfam:Glyco_hydro_38C 67 469 2.5e-80 PFAM
low complexity region 483 493 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000114319
Gene: ENSMUSG00000029119
AA Change: Q37H

DomainStartEndE-ValueType
Pfam:Glyco_hydro_38C 2 86 4.2e-8 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb A C 5: 114,165,738 D74A probably benign Het
Alox15 T C 11: 70,350,253 probably null Het
Ano5 A G 7: 51,573,057 T455A probably benign Het
Ano5 T G 7: 51,590,655 I827S probably damaging Het
Arid1a G A 4: 133,752,611 A334V probably benign Het
Atp13a4 A G 16: 29,459,487 C298R Het
Atp4a T A 7: 30,715,553 S256T probably damaging Het
Atp6v1c1 G A 15: 38,686,805 V215I probably benign Het
Bbs9 T A 9: 22,670,813 F600L probably benign Het
Bmp8b A T 4: 123,124,464 Y376F possibly damaging Het
Cacna2d1 A T 5: 16,362,349 D986V probably damaging Het
Ccdc162 A G 10: 41,627,227 F973S possibly damaging Het
Ccdc177 G A 12: 80,757,938 Q521* probably null Het
Cd209b T A 8: 3,923,299 E158D possibly damaging Het
Cdk14 G A 5: 5,380,061 T22I possibly damaging Het
Chl1 A T 6: 103,711,102 I968F possibly damaging Het
Cnot7 T C 8: 40,494,081 Y255C probably damaging Het
Col4a2 T A 8: 11,425,376 L600H probably benign Het
Cpne7 C A 8: 123,124,181 L129M probably damaging Het
Cpxm2 G T 7: 132,154,378 P79Q possibly damaging Het
Dhx9 T A 1: 153,465,001 N631I probably benign Het
Dmxl1 T C 18: 49,893,461 S1879P probably damaging Het
Dnhd1 T A 7: 105,651,624 F63I probably benign Het
Dok7 A G 5: 35,066,522 N98S probably damaging Het
Fgd2 A G 17: 29,376,912 T515A probably benign Het
Fmo1 T C 1: 162,836,135 D275G probably benign Het
Gm5796 A G 14: 4,034,759 Y90C probably damaging Het
H60b C A 10: 22,285,738 H42N possibly damaging Het
Hipk2 A G 6: 38,703,634 S924P probably benign Het
Hpf1 C A 8: 60,905,579 S27* probably null Het
Idua T G 5: 108,681,522 D443E probably benign Het
Lamc2 C T 1: 153,133,611 G816D possibly damaging Het
Lgi3 T A 14: 70,531,111 V16E unknown Het
Lpar1 T A 4: 58,486,795 M159L probably benign Het
Magi2 A G 5: 20,550,282 D618G possibly damaging Het
March7 A T 2: 60,234,990 K537* probably null Het
Mcoln1 T C 8: 3,505,873 F56S probably damaging Het
Myh7 C G 14: 54,988,801 D461H probably damaging Het
Myo1b A T 1: 51,793,677 M383K probably damaging Het
Olfr160 T C 9: 37,712,133 I49V probably damaging Het
Olfr161 T C 16: 3,592,431 F12L probably damaging Het
Olfr360 A T 2: 37,068,904 T200S probably damaging Het
Pars2 T A 4: 106,654,079 Y353N probably damaging Het
Pcdha8 A C 18: 36,992,684 D73A possibly damaging Het
Pcdhga8 C T 18: 37,727,049 T386M possibly damaging Het
Pdzd2 G T 15: 12,407,336 T346N probably damaging Het
Pik3c2b A G 1: 133,085,611 Q781R probably damaging Het
Pp2d1 T A 17: 53,508,290 T469S possibly damaging Het
Sectm1a G A 11: 121,068,805 L166F probably damaging Het
Sgms1 T A 19: 32,142,769 M246L probably benign Het
Shroom3 G A 5: 92,950,947 G1429S probably benign Het
Snx17 T A 5: 31,195,460 F101Y probably damaging Het
Sowahb C T 5: 93,043,381 S493N probably benign Het
Spc25 T A 2: 69,206,137 R7S unknown Het
Sult2b1 A G 7: 45,730,196 I308T probably benign Het
Tkt A G 14: 30,558,806 N65D probably benign Het
Ttc5 A T 14: 50,773,312 S221T probably benign Het
Ubr5 G A 15: 37,979,832 A2434V probably null Het
Wipf1 A C 2: 73,444,461 S55R probably damaging Het
Zdbf2 T C 1: 63,305,371 S970P possibly damaging Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,815,240 probably benign Het
Zfp362 A T 4: 128,777,410 H313Q probably benign Het
Zfy2 T A Y: 2,121,420 I158F probably benign Het
Other mutations in Man2b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00970:Man2b2 APN 5 36816143 nonsense probably null
IGL01098:Man2b2 APN 5 36815556 missense probably damaging 1.00
IGL01367:Man2b2 APN 5 36814337 nonsense probably null
IGL01781:Man2b2 APN 5 36813745 missense possibly damaging 0.80
IGL01809:Man2b2 APN 5 36814516 missense probably benign 0.01
IGL02824:Man2b2 APN 5 36821851 missense probably benign 0.09
IGL03323:Man2b2 APN 5 36818514 missense probably benign 0.07
IGL03333:Man2b2 APN 5 36816139 missense probably damaging 0.96
R0505:Man2b2 UTSW 5 36816198 missense probably benign 0.00
R0715:Man2b2 UTSW 5 36826058 missense probably benign 0.00
R1435:Man2b2 UTSW 5 36813067 missense probably damaging 0.98
R1536:Man2b2 UTSW 5 36820927 missense probably benign 0.10
R1944:Man2b2 UTSW 5 36816180 missense probably benign
R2079:Man2b2 UTSW 5 36814372 missense possibly damaging 0.64
R2475:Man2b2 UTSW 5 36807875 missense probably benign 0.01
R2924:Man2b2 UTSW 5 36824102 missense probably benign 0.01
R2925:Man2b2 UTSW 5 36824102 missense probably benign 0.01
R2938:Man2b2 UTSW 5 36820986 missense probably benign 0.27
R3777:Man2b2 UTSW 5 36815527 missense probably benign 0.00
R3778:Man2b2 UTSW 5 36815527 missense probably benign 0.00
R3982:Man2b2 UTSW 5 36813820 missense probably benign 0.10
R4618:Man2b2 UTSW 5 36817639 missense probably benign 0.06
R4822:Man2b2 UTSW 5 36815521 missense probably damaging 1.00
R5320:Man2b2 UTSW 5 36810333 missense probably damaging 1.00
R5394:Man2b2 UTSW 5 36814518 missense probably benign 0.03
R5468:Man2b2 UTSW 5 36807175 missense probably benign 0.00
R5993:Man2b2 UTSW 5 36820980 missense probably benign 0.12
R6053:Man2b2 UTSW 5 36813038 missense probably benign 0.00
R6083:Man2b2 UTSW 5 36809041 missense probably damaging 1.00
R6376:Man2b2 UTSW 5 36821034 missense probably damaging 1.00
R6669:Man2b2 UTSW 5 36810358 missense probably benign 0.00
R7000:Man2b2 UTSW 5 36821869 missense probably damaging 1.00
R7108:Man2b2 UTSW 5 36815485 missense probably benign 0.04
R7376:Man2b2 UTSW 5 36813378 missense probably damaging 1.00
R7478:Man2b2 UTSW 5 36810313 missense probably damaging 1.00
R8059:Man2b2 UTSW 5 36816160 missense probably damaging 1.00
X0022:Man2b2 UTSW 5 36813892 missense probably damaging 0.99
Z1088:Man2b2 UTSW 5 36815356 missense possibly damaging 0.46
Z1177:Man2b2 UTSW 5 36813797 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGATCCTAACACAGGGCAGC -3'
(R):5'- ACTGGATGTGTCGAGAGCAG -3'

Sequencing Primer
(F):5'- AGCCTGAGGACACTGTCTG -3'
(R):5'- GGCCTGAGGTGTGAACC -3'
Posted On2019-11-12