Mutagenetix > Incidental Mutations

Incidental Mutation 'R7712:Shroom3'

594673

Institutional Source

Beutler Lab

Gene Symbol

Shroom3

Ensembl Gene

ENSMUSG00000029381

Gene Name

shroom family member 3

Synonyms

D5Ertd287e, Shrm3, Shrm

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7712 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

92683435-92965318 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 92950947 bp

Zygosity

Heterozygous

Amino Acid Change

Glycine to Serine at position 1429 (G1429S)

Ref Sequence

ENSEMBL: ENSMUSP00000108678 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000113051] [ENSMUST00000113054] [ENSMUST00000113055] [ENSMUST00000168878] [ENSMUST00000225438]

Predicted Effect

probably benign
Transcript: ENSMUST00000113051
AA Change: G1254S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000108674
Gene: ENSMUSG00000029381
AA Change: G1254S

Domain	Start	End	E-Value	Type
low complexity region	16	27	N/A	INTRINSIC
low complexity region	83	93	N/A	INTRINSIC
low complexity region	572	586	N/A	INTRINSIC
low complexity region	621	639	N/A	INTRINSIC
low complexity region	685	704	N/A	INTRINSIC
Pfam:ASD1	706	885	2.3e-65	PFAM
low complexity region	939	952	N/A	INTRINSIC
low complexity region	1132	1143	N/A	INTRINSIC
low complexity region	1172	1184	N/A	INTRINSIC
low complexity region	1274	1288	N/A	INTRINSIC
low complexity region	1333	1345	N/A	INTRINSIC
Pfam:ASD2	1478	1765	3.1e-107	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000113054
AA Change: G1254S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000108677
Gene: ENSMUSG00000029381
AA Change: G1254S

Domain	Start	End	E-Value	Type
low complexity region	16	27	N/A	INTRINSIC
low complexity region	83	93	N/A	INTRINSIC
low complexity region	572	586	N/A	INTRINSIC
low complexity region	621	639	N/A	INTRINSIC
low complexity region	685	704	N/A	INTRINSIC
Pfam:ASD1	706	885	2.3e-65	PFAM
low complexity region	939	952	N/A	INTRINSIC
low complexity region	1132	1143	N/A	INTRINSIC
low complexity region	1172	1184	N/A	INTRINSIC
low complexity region	1274	1288	N/A	INTRINSIC
low complexity region	1333	1345	N/A	INTRINSIC
Pfam:ASD2	1478	1765	3.1e-107	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000113055
AA Change: G1429S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000108678
Gene: ENSMUSG00000029381
AA Change: G1429S

Domain	Start	End	E-Value	Type
PDZ	35	109	5.81e-11	SMART
low complexity region	191	202	N/A	INTRINSIC
low complexity region	258	268	N/A	INTRINSIC
low complexity region	747	761	N/A	INTRINSIC
low complexity region	796	814	N/A	INTRINSIC
low complexity region	860	879	N/A	INTRINSIC
Pfam:ASD1	882	1060	1e-57	PFAM
low complexity region	1114	1127	N/A	INTRINSIC
low complexity region	1307	1318	N/A	INTRINSIC
low complexity region	1347	1359	N/A	INTRINSIC
low complexity region	1449	1463	N/A	INTRINSIC
low complexity region	1508	1520	N/A	INTRINSIC
Pfam:ASD2	1654	1940	9.9e-112	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000168878
AA Change: G1298S

SMART Domains

Protein: ENSMUSP00000130419
Gene: ENSMUSG00000029381
AA Change: G1298S

Domain	Start	End	E-Value	Type
PDZ	35	109	5.81e-11	SMART
low complexity region	191	202	N/A	INTRINSIC
low complexity region	258	268	N/A	INTRINSIC
low complexity region	747	761	N/A	INTRINSIC
low complexity region	796	814	N/A	INTRINSIC
low complexity region	860	879	N/A	INTRINSIC
low complexity region	983	996	N/A	INTRINSIC
low complexity region	1176	1187	N/A	INTRINSIC
low complexity region	1216	1228	N/A	INTRINSIC
low complexity region	1318	1332	N/A	INTRINSIC
low complexity region	1377	1389	N/A	INTRINSIC
Pfam:ASD2	1522	1809	8.9e-108	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000225438
AA Change: G1348S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a PDZ-domain-containing protein that belongs to a family of Shroom-related proteins. This protein may be involved in regulating cell shape in certain tissues. A similar protein in mice is required for proper neurulation. [provided by RefSeq, Jan 2011]
PHENOTYPE: Homozygous mutation of this locus results in failed neural tube closure leading to exencephaly, acrania, facial clefting, and spina bifida. Homozygotes develop to term but die either at birth or shortly thereafter. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acacb	A	C	5: 114,165,738	D74A	probably benign	Het
Alox15	T	C	11: 70,350,253		probably null	Het
Ano5	A	G	7: 51,573,057	T455A	probably benign	Het
Ano5	T	G	7: 51,590,655	I827S	probably damaging	Het
Arid1a	G	A	4: 133,752,611	A334V	probably benign	Het
Atp13a4	A	G	16: 29,459,487	C298R		Het
Atp4a	T	A	7: 30,715,553	S256T	probably damaging	Het
Atp6v1c1	G	A	15: 38,686,805	V215I	probably benign	Het
Bbs9	T	A	9: 22,670,813	F600L	probably benign	Het
Bmp8b	A	T	4: 123,124,464	Y376F	possibly damaging	Het
Cacna2d1	A	T	5: 16,362,349	D986V	probably damaging	Het
Ccdc162	A	G	10: 41,627,227	F973S	possibly damaging	Het
Ccdc177	G	A	12: 80,757,938	Q521*	probably null	Het
Cd209b	T	A	8: 3,923,299	E158D	possibly damaging	Het
Cdk14	G	A	5: 5,380,061	T22I	possibly damaging	Het
Chl1	A	T	6: 103,711,102	I968F	possibly damaging	Het
Cnot7	T	C	8: 40,494,081	Y255C	probably damaging	Het
Col4a2	T	A	8: 11,425,376	L600H	probably benign	Het
Cpne7	C	A	8: 123,124,181	L129M	probably damaging	Het
Cpxm2	G	T	7: 132,154,378	P79Q	possibly damaging	Het
Dhx9	T	A	1: 153,465,001	N631I	probably benign	Het
Dmxl1	T	C	18: 49,893,461	S1879P	probably damaging	Het
Dnhd1	T	A	7: 105,651,624	F63I	probably benign	Het
Dok7	A	G	5: 35,066,522	N98S	probably damaging	Het
Fgd2	A	G	17: 29,376,912	T515A	probably benign	Het
Fmo1	T	C	1: 162,836,135	D275G	probably benign	Het
Gm5796	A	G	14: 4,034,759	Y90C	probably damaging	Het
H60b	C	A	10: 22,285,738	H42N	possibly damaging	Het
Hipk2	A	G	6: 38,703,634	S924P	probably benign	Het
Hpf1	C	A	8: 60,905,579	S27*	probably null	Het
Idua	T	G	5: 108,681,522	D443E	probably benign	Het
Lamc2	C	T	1: 153,133,611	G816D	possibly damaging	Het
Lgi3	T	A	14: 70,531,111	V16E	unknown	Het
Lpar1	T	A	4: 58,486,795	M159L	probably benign	Het
Magi2	A	G	5: 20,550,282	D618G	possibly damaging	Het
Man2b2	C	G	5: 36,810,314	Q903H	probably benign	Het
March7	A	T	2: 60,234,990	K537*	probably null	Het
Mcoln1	T	C	8: 3,505,873	F56S	probably damaging	Het
Myh7	C	G	14: 54,988,801	D461H	probably damaging	Het
Myo1b	A	T	1: 51,793,677	M383K	probably damaging	Het
Olfr160	T	C	9: 37,712,133	I49V	probably damaging	Het
Olfr161	T	C	16: 3,592,431	F12L	probably damaging	Het
Olfr360	A	T	2: 37,068,904	T200S	probably damaging	Het
Pars2	T	A	4: 106,654,079	Y353N	probably damaging	Het
Pcdha8	A	C	18: 36,992,684	D73A	possibly damaging	Het
Pcdhga8	C	T	18: 37,727,049	T386M	possibly damaging	Het
Pdzd2	G	T	15: 12,407,336	T346N	probably damaging	Het
Pik3c2b	A	G	1: 133,085,611	Q781R	probably damaging	Het
Pp2d1	T	A	17: 53,508,290	T469S	possibly damaging	Het
Sectm1a	G	A	11: 121,068,805	L166F	probably damaging	Het
Sgms1	T	A	19: 32,142,769	M246L	probably benign	Het
Snx17	T	A	5: 31,195,460	F101Y	probably damaging	Het
Sowahb	C	T	5: 93,043,381	S493N	probably benign	Het
Spc25	T	A	2: 69,206,137	R7S	unknown	Het
Sult2b1	A	G	7: 45,730,196	I308T	probably benign	Het
Tkt	A	G	14: 30,558,806	N65D	probably benign	Het
Ttc5	A	T	14: 50,773,312	S221T	probably benign	Het
Ubr5	G	A	15: 37,979,832	A2434V	probably null	Het
Wipf1	A	C	2: 73,444,461	S55R	probably damaging	Het
Zdbf2	T	C	1: 63,305,371	S970P	possibly damaging	Het
Zfp354c	TCACACTCGGCACA	TCACA	11: 50,815,240		probably benign	Het
Zfp362	A	T	4: 128,777,410	H313Q	probably benign	Het
Zfy2	T	A	Y: 2,121,420	I158F	probably benign	Het

Other mutations in Shroom3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00850:Shroom3	APN	5	92951065	missense	probably damaging	1.00
IGL01086:Shroom3	APN	5	92948452	missense	probably benign	0.01
IGL01363:Shroom3	APN	5	92940993	missense	probably benign	0.01
IGL01468:Shroom3	APN	5	92940342	missense	probably damaging	1.00
IGL01675:Shroom3	APN	5	92941680	missense	probably damaging	0.99
IGL01862:Shroom3	APN	5	92962289	missense	probably damaging	1.00
IGL01987:Shroom3	APN	5	92942189	missense	probably damaging	0.99
IGL02104:Shroom3	APN	5	92940389	missense	probably benign	0.32
IGL03248:Shroom3	APN	5	92952540	missense	probably benign	0.00
IGL03386:Shroom3	APN	5	92948483	splice site	probably benign
R0167:Shroom3	UTSW	5	92948395	splice site	probably benign
R0388:Shroom3	UTSW	5	92951293	missense	probably benign	0.39
R0395:Shroom3	UTSW	5	92780903	missense	probably damaging	1.00
R0567:Shroom3	UTSW	5	92964453	missense	possibly damaging	0.53
R1496:Shroom3	UTSW	5	92942834	missense	possibly damaging	0.69
R1772:Shroom3	UTSW	5	92940656	missense	probably damaging	0.97
R1845:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R1921:Shroom3	UTSW	5	92962365	critical splice donor site	probably null
R2059:Shroom3	UTSW	5	92683784	missense	probably damaging	1.00
R2203:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2204:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2205:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2301:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2344:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2345:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2346:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2348:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2371:Shroom3	UTSW	5	92780870	missense	probably damaging	1.00
R2435:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2829:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2830:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2831:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2897:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2898:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3079:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3080:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3433:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3729:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3730:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3735:Shroom3	UTSW	5	92964444	missense	possibly damaging	0.84
R3736:Shroom3	UTSW	5	92964444	missense	possibly damaging	0.84
R3851:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3852:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3943:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3969:Shroom3	UTSW	5	92940879	missense	probably benign	0.05
R4008:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4009:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4012:Shroom3	UTSW	5	92948483	splice site	probably benign
R4154:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4157:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4172:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4173:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4201:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4202:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4204:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4205:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4206:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4284:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4285:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4364:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4384:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4456:Shroom3	UTSW	5	92940999	missense	probably benign	0.14
R4707:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4712:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4751:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4755:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4760:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4773:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4774:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4776:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4801:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4802:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4856:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4857:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4860:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4860:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4882:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4883:Shroom3	UTSW	5	92951134	missense	probably benign	0.14
R4886:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R5262:Shroom3	UTSW	5	92964573	missense	probably damaging	1.00
R5271:Shroom3	UTSW	5	92962248	missense	probably damaging	1.00
R5719:Shroom3	UTSW	5	92943018	missense	probably benign	0.04
R5726:Shroom3	UTSW	5	92943005	missense	probably benign	0.00
R5993:Shroom3	UTSW	5	92940188	missense	probably damaging	1.00
R6078:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R6079:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R6138:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R6153:Shroom3	UTSW	5	92964408	missense	probably damaging	0.99
R6493:Shroom3	UTSW	5	92941561	missense	probably benign	0.03
R6495:Shroom3	UTSW	5	92942069	missense	possibly damaging	0.66
R6693:Shroom3	UTSW	5	92940758	missense	possibly damaging	0.61
R6801:Shroom3	UTSW	5	92940936	missense	probably damaging	1.00
R6893:Shroom3	UTSW	5	92942204	missense	probably damaging	0.97
R6912:Shroom3	UTSW	5	92943017	missense	probably benign	0.02
R6924:Shroom3	UTSW	5	92964403	missense	probably damaging	1.00
R7083:Shroom3	UTSW	5	92964525	missense	probably damaging	1.00
R7197:Shroom3	UTSW	5	92942604	missense	probably damaging	1.00
R7366:Shroom3	UTSW	5	92964606	nonsense	probably null
R7725:Shroom3	UTSW	5	92941653	missense	probably benign	0.19
R7728:Shroom3	UTSW	5	92683707	missense	possibly damaging	0.73
R7774:Shroom3	UTSW	5	92950489	missense	probably damaging	0.98
R7795:Shroom3	UTSW	5	92919649	missense	probably damaging	0.99
R7821:Shroom3	UTSW	5	92940846	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- AGCTTGCCATGGATCAGCAG -3'
(R):5'- GGGTGCAAGTCCTTCATGAAC -3'

Sequencing Primer
(F):5'- TTGCCATGGATCAGCAGACTGG -3'
(R):5'- GGTGCAAGTCCTTCATGAACACTTC -3'

Posted On

2019-11-12