Incidental Mutation 'R7712:Atp4a'
ID594679
Institutional Source Beutler Lab
Gene Symbol Atp4a
Ensembl Gene ENSMUSG00000005553
Gene NameATPase, H+/K+ exchanging, gastric, alpha polypeptide
SynonymsH+/K+-ATPase alpha, H+K+-transporting alpha 1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R7712 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location30712209-30725534 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 30715553 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 256 (S256T)
Ref Sequence ENSEMBL: ENSMUSP00000131964 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005692] [ENSMUST00000170371] [ENSMUST00000171014]
Predicted Effect probably damaging
Transcript: ENSMUST00000005692
AA Change: S256T

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000005692
Gene: ENSMUSG00000005553
AA Change: S256T

DomainStartEndE-ValueType
Pfam:H-K_ATPase_N 2 42 5.4e-23 PFAM
Cation_ATPase_N 52 126 2.26e-18 SMART
Pfam:E1-E2_ATPase 144 375 1.1e-57 PFAM
Pfam:Hydrolase 380 739 5.3e-16 PFAM
Pfam:HAD 383 736 1.9e-18 PFAM
Pfam:Cation_ATPase 436 531 1.6e-24 PFAM
Pfam:Cation_ATPase_C 809 1019 4.8e-43 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000170371
AA Change: S256T

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000131964
Gene: ENSMUSG00000005553
AA Change: S256T

DomainStartEndE-ValueType
Pfam:H-K_ATPase_N 2 42 4.9e-28 PFAM
Cation_ATPase_N 52 126 2.26e-18 SMART
Pfam:E1-E2_ATPase 145 376 1e-62 PFAM
Pfam:Hydrolase 380 730 9.3e-25 PFAM
Pfam:HAD 383 727 2.1e-15 PFAM
Pfam:Hydrolase_like2 436 531 4e-25 PFAM
Pfam:Cation_ATPase_C 800 1010 1.5e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171014
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a family of P-type cation-transporting ATPases. The gastric H+, K+-ATPase is a heterodimer consisting of a high molecular weight catalytic alpha subunit and a smaller but heavily glycosylated beta subunit. This enzyme is a proton pump that catalyzes the hydrolysis of ATP coupled with the exchange of H(+) and K(+) ions across the plasma membrane. It is also responsible for gastric acid secretion. This gene encodes a catalytic alpha subunit of the gastric H+, K+-ATPase. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in achlorhydria, hypergastrinemia, and abnormalities of the parietal cells. Mice homozygous for an ENU-induced allele exhibit iron-deficiency anemia. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(2)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb A C 5: 114,165,738 D74A probably benign Het
Alox15 T C 11: 70,350,253 probably null Het
Ano5 A G 7: 51,573,057 T455A probably benign Het
Ano5 T G 7: 51,590,655 I827S probably damaging Het
Arid1a G A 4: 133,752,611 A334V probably benign Het
Atp13a4 A G 16: 29,459,487 C298R Het
Atp6v1c1 G A 15: 38,686,805 V215I probably benign Het
Bbs9 T A 9: 22,670,813 F600L probably benign Het
Bmp8b A T 4: 123,124,464 Y376F possibly damaging Het
Cacna2d1 A T 5: 16,362,349 D986V probably damaging Het
Ccdc162 A G 10: 41,627,227 F973S possibly damaging Het
Ccdc177 G A 12: 80,757,938 Q521* probably null Het
Cd209b T A 8: 3,923,299 E158D possibly damaging Het
Cdk14 G A 5: 5,380,061 T22I possibly damaging Het
Chl1 A T 6: 103,711,102 I968F possibly damaging Het
Cnot7 T C 8: 40,494,081 Y255C probably damaging Het
Col4a2 T A 8: 11,425,376 L600H probably benign Het
Cpne7 C A 8: 123,124,181 L129M probably damaging Het
Cpxm2 G T 7: 132,154,378 P79Q possibly damaging Het
Dhx9 T A 1: 153,465,001 N631I probably benign Het
Dmxl1 T C 18: 49,893,461 S1879P probably damaging Het
Dnhd1 T A 7: 105,651,624 F63I probably benign Het
Dok7 A G 5: 35,066,522 N98S probably damaging Het
Fgd2 A G 17: 29,376,912 T515A probably benign Het
Fmo1 T C 1: 162,836,135 D275G probably benign Het
Gm5796 A G 14: 4,034,759 Y90C probably damaging Het
H60b C A 10: 22,285,738 H42N possibly damaging Het
Hipk2 A G 6: 38,703,634 S924P probably benign Het
Hpf1 C A 8: 60,905,579 S27* probably null Het
Idua T G 5: 108,681,522 D443E probably benign Het
Lamc2 C T 1: 153,133,611 G816D possibly damaging Het
Lgi3 T A 14: 70,531,111 V16E unknown Het
Lpar1 T A 4: 58,486,795 M159L probably benign Het
Magi2 A G 5: 20,550,282 D618G possibly damaging Het
Man2b2 C G 5: 36,810,314 Q903H probably benign Het
March7 A T 2: 60,234,990 K537* probably null Het
Mcoln1 T C 8: 3,505,873 F56S probably damaging Het
Myh7 C G 14: 54,988,801 D461H probably damaging Het
Myo1b A T 1: 51,793,677 M383K probably damaging Het
Olfr160 T C 9: 37,712,133 I49V probably damaging Het
Olfr161 T C 16: 3,592,431 F12L probably damaging Het
Olfr360 A T 2: 37,068,904 T200S probably damaging Het
Pars2 T A 4: 106,654,079 Y353N probably damaging Het
Pcdha8 A C 18: 36,992,684 D73A possibly damaging Het
Pcdhga8 C T 18: 37,727,049 T386M possibly damaging Het
Pdzd2 G T 15: 12,407,336 T346N probably damaging Het
Pik3c2b A G 1: 133,085,611 Q781R probably damaging Het
Pp2d1 T A 17: 53,508,290 T469S possibly damaging Het
Sectm1a G A 11: 121,068,805 L166F probably damaging Het
Sgms1 T A 19: 32,142,769 M246L probably benign Het
Shroom3 G A 5: 92,950,947 G1429S probably benign Het
Snx17 T A 5: 31,195,460 F101Y probably damaging Het
Sowahb C T 5: 93,043,381 S493N probably benign Het
Spc25 T A 2: 69,206,137 R7S unknown Het
Sult2b1 A G 7: 45,730,196 I308T probably benign Het
Tkt A G 14: 30,558,806 N65D probably benign Het
Ttc5 A T 14: 50,773,312 S221T probably benign Het
Ubr5 G A 15: 37,979,832 A2434V probably null Het
Wipf1 A C 2: 73,444,461 S55R probably damaging Het
Zdbf2 T C 1: 63,305,371 S970P possibly damaging Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,815,240 probably benign Het
Zfp362 A T 4: 128,777,410 H313Q probably benign Het
Zfy2 T A Y: 2,121,420 I158F probably benign Het
Other mutations in Atp4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Atp4a APN 7 30713204 missense possibly damaging 0.95
IGL01327:Atp4a APN 7 30713250 missense possibly damaging 0.96
IGL01510:Atp4a APN 7 30720791 missense probably benign 0.02
IGL01763:Atp4a APN 7 30715518 missense probably benign 0.20
IGL02061:Atp4a APN 7 30715029 missense probably damaging 1.00
IGL02435:Atp4a APN 7 30717057 missense probably benign
IGL02903:Atp4a APN 7 30715919 missense probably benign 0.00
IGL03181:Atp4a APN 7 30724704 missense probably benign 0.02
IGL03350:Atp4a APN 7 30720867 missense probably damaging 1.00
sublytic UTSW 7 30715800 missense probably benign 0.32
IGL03097:Atp4a UTSW 7 30723037 missense probably benign 0.14
R0095:Atp4a UTSW 7 30720735 missense probably damaging 0.99
R0121:Atp4a UTSW 7 30720101 missense probably benign 0.00
R0140:Atp4a UTSW 7 30720101 missense probably benign 0.00
R0241:Atp4a UTSW 7 30717135 missense probably benign 0.00
R0437:Atp4a UTSW 7 30720101 missense probably benign 0.00
R0624:Atp4a UTSW 7 30718999 missense probably benign
R1164:Atp4a UTSW 7 30717692 missense probably benign 0.00
R2105:Atp4a UTSW 7 30720368 critical splice donor site probably null
R2272:Atp4a UTSW 7 30715500 nonsense probably null
R2327:Atp4a UTSW 7 30720241 missense probably benign 0.16
R2881:Atp4a UTSW 7 30720225 missense probably benign 0.16
R2990:Atp4a UTSW 7 30720225 missense probably benign 0.16
R2992:Atp4a UTSW 7 30720225 missense probably benign 0.16
R2993:Atp4a UTSW 7 30720225 missense probably benign 0.16
R3123:Atp4a UTSW 7 30720225 missense probably benign 0.16
R3125:Atp4a UTSW 7 30720225 missense probably benign 0.16
R3441:Atp4a UTSW 7 30720225 missense probably benign 0.16
R3442:Atp4a UTSW 7 30720225 missense probably benign 0.16
R3686:Atp4a UTSW 7 30720225 missense probably benign 0.16
R3687:Atp4a UTSW 7 30720225 missense probably benign 0.16
R3845:Atp4a UTSW 7 30717115 missense probably null 0.99
R4027:Atp4a UTSW 7 30724952 splice site probably null
R4072:Atp4a UTSW 7 30715332 missense probably benign 0.09
R4433:Atp4a UTSW 7 30720225 missense probably benign 0.16
R4454:Atp4a UTSW 7 30720225 missense probably benign 0.16
R4457:Atp4a UTSW 7 30720225 missense probably benign 0.16
R4458:Atp4a UTSW 7 30720225 missense probably benign 0.16
R4510:Atp4a UTSW 7 30724253 nonsense probably null
R4511:Atp4a UTSW 7 30724253 nonsense probably null
R4576:Atp4a UTSW 7 30717722 missense probably benign 0.25
R4656:Atp4a UTSW 7 30719948 intron probably benign
R4661:Atp4a UTSW 7 30720225 missense probably benign 0.16
R4662:Atp4a UTSW 7 30720225 missense probably benign 0.16
R4852:Atp4a UTSW 7 30724268 missense probably benign 0.10
R4892:Atp4a UTSW 7 30712474 missense probably benign 0.07
R4907:Atp4a UTSW 7 30719092 missense possibly damaging 0.66
R5024:Atp4a UTSW 7 30715864 missense possibly damaging 0.82
R5254:Atp4a UTSW 7 30715530 missense probably damaging 1.00
R5318:Atp4a UTSW 7 30715329 missense probably damaging 1.00
R5340:Atp4a UTSW 7 30720806 missense probably benign
R5484:Atp4a UTSW 7 30720672 unclassified probably benign
R5729:Atp4a UTSW 7 30712426 missense possibly damaging 0.48
R5762:Atp4a UTSW 7 30719096 missense probably damaging 0.99
R5797:Atp4a UTSW 7 30712649 missense probably damaging 1.00
R6030:Atp4a UTSW 7 30722516 missense probably damaging 0.99
R6030:Atp4a UTSW 7 30722516 missense probably damaging 0.99
R6077:Atp4a UTSW 7 30715919 missense probably benign 0.00
R6243:Atp4a UTSW 7 30715957 missense possibly damaging 0.68
R6346:Atp4a UTSW 7 30715356 missense possibly damaging 0.84
R6459:Atp4a UTSW 7 30712462 missense probably benign 0.00
R6515:Atp4a UTSW 7 30712478 missense possibly damaging 0.78
R6773:Atp4a UTSW 7 30715377 missense probably damaging 0.98
R6854:Atp4a UTSW 7 30715008 missense probably benign 0.29
R7215:Atp4a UTSW 7 30717360 missense possibly damaging 0.61
R7271:Atp4a UTSW 7 30722519 missense probably benign 0.16
R7340:Atp4a UTSW 7 30716730 missense possibly damaging 0.94
R7457:Atp4a UTSW 7 30720767 missense probably benign 0.08
R7593:Atp4a UTSW 7 30724680 missense probably benign 0.08
R7762:Atp4a UTSW 7 30720036 missense probably damaging 0.96
Z1177:Atp4a UTSW 7 30717840 missense not run
Predicted Primers PCR Primer
(F):5'- AGATCAACGCGGATCAGCTTG -3'
(R):5'- AAACCCTGAGCTGTTCCTGC -3'

Sequencing Primer
(F):5'- CAGCTTGTGGTGGGCGAC -3'
(R):5'- AGCTGTTCCTGCAGTGGC -3'
Posted On2019-11-12