Incidental Mutation 'R7712:Mcoln1'
ID594685
Institutional Source Beutler Lab
Gene Symbol Mcoln1
Ensembl Gene ENSMUSG00000004567
Gene Namemucolipin 1
SynonymsTRPML1, mucolipidin, 2210015I05Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.152) question?
Stock #R7712 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location3500457-3515232 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 3505873 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 56 (F56S)
Ref Sequence ENSEMBL: ENSMUSP00000004683 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004683] [ENSMUST00000160338] [ENSMUST00000208306]
Predicted Effect probably damaging
Transcript: ENSMUST00000004683
AA Change: F56S

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000004683
Gene: ENSMUSG00000004567
AA Change: F56S

DomainStartEndE-ValueType
low complexity region 30 39 N/A INTRINSIC
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 299 321 N/A INTRINSIC
transmembrane domain 348 370 N/A INTRINSIC
Pfam:PKD_channel 378 524 2.1e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000160338
AA Change: F56S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123717
Gene: ENSMUSG00000004567
AA Change: F56S

DomainStartEndE-ValueType
low complexity region 30 39 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000208306
AA Change: F56S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a memberof the transient receptor potential (TRP) cation channel gene family. The transmembrane protein localizes to intracellular vesicular membranes including lysosomes, and functions in the late endocytic pathway and in the regulation of lysosomal exocytosis. The channel is permeable to Ca(2+), Fe(2+), Na(+), K(+), and H(+), and is modulated by changes in Ca(2+) concentration. Mutations in this gene result in mucolipidosis type IV. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit premature death around 8 months of age preceeded by weight loss, weakness, lethargy, bladder and stomach distension, and retinal degradation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb A C 5: 114,165,738 D74A probably benign Het
Alox15 T C 11: 70,350,253 probably null Het
Ano5 A G 7: 51,573,057 T455A probably benign Het
Ano5 T G 7: 51,590,655 I827S probably damaging Het
Arid1a G A 4: 133,752,611 A334V probably benign Het
Atp13a4 A G 16: 29,459,487 C298R Het
Atp4a T A 7: 30,715,553 S256T probably damaging Het
Atp6v1c1 G A 15: 38,686,805 V215I probably benign Het
Bbs9 T A 9: 22,670,813 F600L probably benign Het
Bmp8b A T 4: 123,124,464 Y376F possibly damaging Het
Cacna2d1 A T 5: 16,362,349 D986V probably damaging Het
Ccdc162 A G 10: 41,627,227 F973S possibly damaging Het
Ccdc177 G A 12: 80,757,938 Q521* probably null Het
Cd209b T A 8: 3,923,299 E158D possibly damaging Het
Cdk14 G A 5: 5,380,061 T22I possibly damaging Het
Chl1 A T 6: 103,711,102 I968F possibly damaging Het
Cnot7 T C 8: 40,494,081 Y255C probably damaging Het
Col4a2 T A 8: 11,425,376 L600H probably benign Het
Cpne7 C A 8: 123,124,181 L129M probably damaging Het
Cpxm2 G T 7: 132,154,378 P79Q possibly damaging Het
Dhx9 T A 1: 153,465,001 N631I probably benign Het
Dmxl1 T C 18: 49,893,461 S1879P probably damaging Het
Dnhd1 T A 7: 105,651,624 F63I probably benign Het
Dok7 A G 5: 35,066,522 N98S probably damaging Het
Fgd2 A G 17: 29,376,912 T515A probably benign Het
Fmo1 T C 1: 162,836,135 D275G probably benign Het
Gm5796 A G 14: 4,034,759 Y90C probably damaging Het
H60b C A 10: 22,285,738 H42N possibly damaging Het
Hipk2 A G 6: 38,703,634 S924P probably benign Het
Hpf1 C A 8: 60,905,579 S27* probably null Het
Idua T G 5: 108,681,522 D443E probably benign Het
Lamc2 C T 1: 153,133,611 G816D possibly damaging Het
Lgi3 T A 14: 70,531,111 V16E unknown Het
Lpar1 T A 4: 58,486,795 M159L probably benign Het
Magi2 A G 5: 20,550,282 D618G possibly damaging Het
Man2b2 C G 5: 36,810,314 Q903H probably benign Het
March7 A T 2: 60,234,990 K537* probably null Het
Myh7 C G 14: 54,988,801 D461H probably damaging Het
Myo1b A T 1: 51,793,677 M383K probably damaging Het
Olfr160 T C 9: 37,712,133 I49V probably damaging Het
Olfr161 T C 16: 3,592,431 F12L probably damaging Het
Olfr360 A T 2: 37,068,904 T200S probably damaging Het
Pars2 T A 4: 106,654,079 Y353N probably damaging Het
Pcdha8 A C 18: 36,992,684 D73A possibly damaging Het
Pcdhga8 C T 18: 37,727,049 T386M possibly damaging Het
Pdzd2 G T 15: 12,407,336 T346N probably damaging Het
Pik3c2b A G 1: 133,085,611 Q781R probably damaging Het
Pp2d1 T A 17: 53,508,290 T469S possibly damaging Het
Sectm1a G A 11: 121,068,805 L166F probably damaging Het
Sgms1 T A 19: 32,142,769 M246L probably benign Het
Shroom3 G A 5: 92,950,947 G1429S probably benign Het
Snx17 T A 5: 31,195,460 F101Y probably damaging Het
Sowahb C T 5: 93,043,381 S493N probably benign Het
Spc25 T A 2: 69,206,137 R7S unknown Het
Sult2b1 A G 7: 45,730,196 I308T probably benign Het
Tkt A G 14: 30,558,806 N65D probably benign Het
Ttc5 A T 14: 50,773,312 S221T probably benign Het
Ubr5 G A 15: 37,979,832 A2434V probably null Het
Wipf1 A C 2: 73,444,461 S55R probably damaging Het
Zdbf2 T C 1: 63,305,371 S970P possibly damaging Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,815,240 probably benign Het
Zfp362 A T 4: 128,777,410 H313Q probably benign Het
Zfy2 T A Y: 2,121,420 I158F probably benign Het
Other mutations in Mcoln1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01362:Mcoln1 APN 8 3507558 missense possibly damaging 0.89
IGL01621:Mcoln1 APN 8 3510910 missense probably damaging 1.00
IGL02147:Mcoln1 APN 8 3508379 missense probably benign
IGL02156:Mcoln1 APN 8 3512657 nonsense probably null
R0616:Mcoln1 UTSW 8 3515025 missense probably benign 0.00
R1498:Mcoln1 UTSW 8 3512861 missense probably damaging 1.00
R2102:Mcoln1 UTSW 8 3511731 missense probably damaging 1.00
R2155:Mcoln1 UTSW 8 3511787 missense probably damaging 1.00
R2178:Mcoln1 UTSW 8 3508766 missense probably damaging 1.00
R2218:Mcoln1 UTSW 8 3505813 missense possibly damaging 0.50
R3828:Mcoln1 UTSW 8 3500601 missense possibly damaging 0.93
R3875:Mcoln1 UTSW 8 3508355 missense probably benign
R3971:Mcoln1 UTSW 8 3507408 missense probably benign 0.01
R4621:Mcoln1 UTSW 8 3505923 missense probably damaging 1.00
R4622:Mcoln1 UTSW 8 3505923 missense probably damaging 1.00
R4659:Mcoln1 UTSW 8 3510840 missense probably damaging 1.00
R4873:Mcoln1 UTSW 8 3507422 missense probably benign 0.00
R4875:Mcoln1 UTSW 8 3507422 missense probably benign 0.00
R4914:Mcoln1 UTSW 8 3507483 nonsense probably null
R5114:Mcoln1 UTSW 8 3510697 unclassified probably benign
R5586:Mcoln1 UTSW 8 3510389 missense probably damaging 1.00
R5876:Mcoln1 UTSW 8 3510910 missense probably damaging 1.00
R5946:Mcoln1 UTSW 8 3508701 missense probably damaging 1.00
R6520:Mcoln1 UTSW 8 3505855 missense probably damaging 1.00
R7449:Mcoln1 UTSW 8 3507285 missense probably damaging 0.98
R7904:Mcoln1 UTSW 8 3508356 missense probably benign
R7987:Mcoln1 UTSW 8 3508356 missense probably benign
R8058:Mcoln1 UTSW 8 3508378
Predicted Primers PCR Primer
(F):5'- CTTGCTGGTGAAGGAAGCAG -3'
(R):5'- CAAATCTCAGATTTCTTCCTGACTGG -3'

Sequencing Primer
(F):5'- AGAGGGCATCGTCCACC -3'
(R):5'- TGACTGGTAATACCACTGTCATC -3'
Posted On2019-11-12