Incidental Mutation 'R7712:Cpne7'
ID594690
Institutional Source Beutler Lab
Gene Symbol Cpne7
Ensembl Gene ENSMUSG00000034796
Gene Namecopine VII
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7712 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location123117374-123135182 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 123124181 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Methionine at position 129 (L129M)
Ref Sequence ENSEMBL: ENSMUSP00000042159 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037900] [ENSMUST00000127664]
Predicted Effect probably damaging
Transcript: ENSMUST00000037900
AA Change: L129M

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000042159
Gene: ENSMUSG00000034796
AA Change: L129M

DomainStartEndE-ValueType
low complexity region 8 17 N/A INTRINSIC
C2 21 127 7.18e-8 SMART
C2 142 259 5.92e-9 SMART
VWA 304 510 7.2e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: Calcium-dependent membrane-binding proteins may regulate molecular events at the interface of the cell membrane and cytoplasm. This gene is one of several genes that encodes a calcium-dependent protein containing two N-terminal type II C2 domains and an integrin A domain-like sequence in the C-terminus. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb A C 5: 114,165,738 D74A probably benign Het
Alox15 T C 11: 70,350,253 probably null Het
Ano5 A G 7: 51,573,057 T455A probably benign Het
Ano5 T G 7: 51,590,655 I827S probably damaging Het
Arid1a G A 4: 133,752,611 A334V probably benign Het
Atp13a4 A G 16: 29,459,487 C298R Het
Atp4a T A 7: 30,715,553 S256T probably damaging Het
Atp6v1c1 G A 15: 38,686,805 V215I probably benign Het
Bbs9 T A 9: 22,670,813 F600L probably benign Het
Bmp8b A T 4: 123,124,464 Y376F possibly damaging Het
Cacna2d1 A T 5: 16,362,349 D986V probably damaging Het
Ccdc162 A G 10: 41,627,227 F973S possibly damaging Het
Ccdc177 G A 12: 80,757,938 Q521* probably null Het
Cd209b T A 8: 3,923,299 E158D possibly damaging Het
Cdk14 G A 5: 5,380,061 T22I possibly damaging Het
Chl1 A T 6: 103,711,102 I968F possibly damaging Het
Cnot7 T C 8: 40,494,081 Y255C probably damaging Het
Col4a2 T A 8: 11,425,376 L600H probably benign Het
Cpxm2 G T 7: 132,154,378 P79Q possibly damaging Het
Dhx9 T A 1: 153,465,001 N631I probably benign Het
Dmxl1 T C 18: 49,893,461 S1879P probably damaging Het
Dnhd1 T A 7: 105,651,624 F63I probably benign Het
Dok7 A G 5: 35,066,522 N98S probably damaging Het
Fgd2 A G 17: 29,376,912 T515A probably benign Het
Fmo1 T C 1: 162,836,135 D275G probably benign Het
Gm5796 A G 14: 4,034,759 Y90C probably damaging Het
H60b C A 10: 22,285,738 H42N possibly damaging Het
Hipk2 A G 6: 38,703,634 S924P probably benign Het
Hpf1 C A 8: 60,905,579 S27* probably null Het
Idua T G 5: 108,681,522 D443E probably benign Het
Lamc2 C T 1: 153,133,611 G816D possibly damaging Het
Lgi3 T A 14: 70,531,111 V16E unknown Het
Lpar1 T A 4: 58,486,795 M159L probably benign Het
Magi2 A G 5: 20,550,282 D618G possibly damaging Het
Man2b2 C G 5: 36,810,314 Q903H probably benign Het
March7 A T 2: 60,234,990 K537* probably null Het
Mcoln1 T C 8: 3,505,873 F56S probably damaging Het
Myh7 C G 14: 54,988,801 D461H probably damaging Het
Myo1b A T 1: 51,793,677 M383K probably damaging Het
Olfr160 T C 9: 37,712,133 I49V probably damaging Het
Olfr161 T C 16: 3,592,431 F12L probably damaging Het
Olfr360 A T 2: 37,068,904 T200S probably damaging Het
Pars2 T A 4: 106,654,079 Y353N probably damaging Het
Pcdha8 A C 18: 36,992,684 D73A possibly damaging Het
Pcdhga8 C T 18: 37,727,049 T386M possibly damaging Het
Pdzd2 G T 15: 12,407,336 T346N probably damaging Het
Pik3c2b A G 1: 133,085,611 Q781R probably damaging Het
Pp2d1 T A 17: 53,508,290 T469S possibly damaging Het
Sectm1a G A 11: 121,068,805 L166F probably damaging Het
Sgms1 T A 19: 32,142,769 M246L probably benign Het
Shroom3 G A 5: 92,950,947 G1429S probably benign Het
Snx17 T A 5: 31,195,460 F101Y probably damaging Het
Sowahb C T 5: 93,043,381 S493N probably benign Het
Spc25 T A 2: 69,206,137 R7S unknown Het
Sult2b1 A G 7: 45,730,196 I308T probably benign Het
Tkt A G 14: 30,558,806 N65D probably benign Het
Ttc5 A T 14: 50,773,312 S221T probably benign Het
Ubr5 G A 15: 37,979,832 A2434V probably null Het
Wipf1 A C 2: 73,444,461 S55R probably damaging Het
Zdbf2 T C 1: 63,305,371 S970P possibly damaging Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,815,240 probably benign Het
Zfp362 A T 4: 128,777,410 H313Q probably benign Het
Zfy2 T A Y: 2,121,420 I158F probably benign Het
Other mutations in Cpne7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01919:Cpne7 APN 8 123125643 missense probably damaging 0.99
IGL02111:Cpne7 APN 8 123125653 intron probably benign
IGL02245:Cpne7 APN 8 123117618 missense probably damaging 1.00
IGL03000:Cpne7 APN 8 123126696 missense probably benign 0.07
R0501:Cpne7 UTSW 8 123126255 missense possibly damaging 0.95
R0727:Cpne7 UTSW 8 123126286 missense probably damaging 0.98
R1750:Cpne7 UTSW 8 123134524 missense probably damaging 1.00
R1991:Cpne7 UTSW 8 123127437 missense possibly damaging 0.94
R2103:Cpne7 UTSW 8 123127437 missense possibly damaging 0.94
R2219:Cpne7 UTSW 8 123124438 missense probably benign 0.12
R2350:Cpne7 UTSW 8 123124469 missense probably damaging 1.00
R2513:Cpne7 UTSW 8 123117667 splice site probably null
R4657:Cpne7 UTSW 8 123134575 makesense probably null
R4961:Cpne7 UTSW 8 123133759 missense probably damaging 0.99
R6148:Cpne7 UTSW 8 123127432 missense probably benign 0.00
R7566:Cpne7 UTSW 8 123133813 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGCCAAGTGATGTCCTCTTC -3'
(R):5'- CCCATGGAATGAGACGGATGTC -3'

Sequencing Primer
(F):5'- GGCTATCCTGGAACTAACTCTGTAG -3'
(R):5'- GACGGATGTCTCACCCCTCTG -3'
Posted On2019-11-12