Incidental Mutation 'R7712:Ccdc162'
ID 594694
Institutional Source Beutler Lab
Gene Symbol Ccdc162
Ensembl Gene ENSMUSG00000075225
Gene Name coiled-coil domain containing 162
Synonyms Gm29096, Gm6976, 5033413D22Rik
MMRRC Submission 045770-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.070) question?
Stock # R7712 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 41414838-41592586 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 41503223 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 973 (F973S)
Ref Sequence ENSEMBL: ENSMUSP00000140774 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019955] [ENSMUST00000099932] [ENSMUST00000189488]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000019955
SMART Domains Protein: ENSMUSP00000019955
Gene: ENSMUSG00000075225

DomainStartEndE-ValueType
coiled coil region 1 37 N/A INTRINSIC
low complexity region 116 138 N/A INTRINSIC
coiled coil region 177 217 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099932
SMART Domains Protein: ENSMUSP00000097516
Gene: ENSMUSG00000075225

DomainStartEndE-ValueType
coiled coil region 327 366 N/A INTRINSIC
low complexity region 490 512 N/A INTRINSIC
coiled coil region 551 607 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000189488
AA Change: F973S

PolyPhen 2 Score 0.556 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000140774
Gene: ENSMUSG00000075225
AA Change: F973S

DomainStartEndE-ValueType
low complexity region 328 347 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb A C 5: 114,303,799 (GRCm39) D74A probably benign Het
Alox15 T C 11: 70,241,079 (GRCm39) probably null Het
Ano5 A G 7: 51,222,805 (GRCm39) T455A probably benign Het
Ano5 T G 7: 51,240,403 (GRCm39) I827S probably damaging Het
Arid1a G A 4: 133,479,922 (GRCm39) A334V probably benign Het
Atp13a4 A G 16: 29,278,305 (GRCm39) C298R Het
Atp4a T A 7: 30,414,978 (GRCm39) S256T probably damaging Het
Atp6v1c1 G A 15: 38,687,049 (GRCm39) V215I probably benign Het
Bbs9 T A 9: 22,582,109 (GRCm39) F600L probably benign Het
Bmp8b A T 4: 123,018,257 (GRCm39) Y376F possibly damaging Het
Cacna2d1 A T 5: 16,567,347 (GRCm39) D986V probably damaging Het
Ccdc177 G A 12: 80,804,712 (GRCm39) Q521* probably null Het
Cd209b T A 8: 3,973,299 (GRCm39) E158D possibly damaging Het
Cdk14 G A 5: 5,430,061 (GRCm39) T22I possibly damaging Het
Chl1 A T 6: 103,688,063 (GRCm39) I968F possibly damaging Het
Cnot7 T C 8: 40,947,122 (GRCm39) Y255C probably damaging Het
Col4a2 T A 8: 11,475,376 (GRCm39) L600H probably benign Het
Cpne7 C A 8: 123,850,920 (GRCm39) L129M probably damaging Het
Cpxm2 G T 7: 131,756,107 (GRCm39) P79Q possibly damaging Het
Dhx9 T A 1: 153,340,747 (GRCm39) N631I probably benign Het
Dmxl1 T C 18: 50,026,528 (GRCm39) S1879P probably damaging Het
Dnhd1 T A 7: 105,300,831 (GRCm39) F63I probably benign Het
Dok7 A G 5: 35,223,866 (GRCm39) N98S probably damaging Het
Fgd2 A G 17: 29,595,886 (GRCm39) T515A probably benign Het
Fmo1 T C 1: 162,663,704 (GRCm39) D275G probably benign Het
Gm5796 A G 14: 15,379,960 (GRCm39) Y90C probably damaging Het
H60b C A 10: 22,161,637 (GRCm39) H42N possibly damaging Het
Hipk2 A G 6: 38,680,569 (GRCm39) S924P probably benign Het
Hpf1 C A 8: 61,358,613 (GRCm39) S27* probably null Het
Idua T G 5: 108,829,388 (GRCm39) D443E probably benign Het
Lamc2 C T 1: 153,009,357 (GRCm39) G816D possibly damaging Het
Lgi3 T A 14: 70,768,551 (GRCm39) V16E unknown Het
Lpar1 T A 4: 58,486,795 (GRCm39) M159L probably benign Het
Magi2 A G 5: 20,755,280 (GRCm39) D618G possibly damaging Het
Man2b2 C G 5: 36,967,658 (GRCm39) Q903H probably benign Het
Marchf7 A T 2: 60,065,334 (GRCm39) K537* probably null Het
Mcoln1 T C 8: 3,555,873 (GRCm39) F56S probably damaging Het
Myh7 C G 14: 55,226,258 (GRCm39) D461H probably damaging Het
Myo1b A T 1: 51,832,836 (GRCm39) M383K probably damaging Het
Or12k7 A T 2: 36,958,916 (GRCm39) T200S probably damaging Het
Or1f19 T C 16: 3,410,295 (GRCm39) F12L probably damaging Het
Or8a1b T C 9: 37,623,429 (GRCm39) I49V probably damaging Het
Pars2 T A 4: 106,511,276 (GRCm39) Y353N probably damaging Het
Pcdha8 A C 18: 37,125,737 (GRCm39) D73A possibly damaging Het
Pcdhga8 C T 18: 37,860,102 (GRCm39) T386M possibly damaging Het
Pdzd2 G T 15: 12,407,422 (GRCm39) T346N probably damaging Het
Pik3c2b A G 1: 133,013,349 (GRCm39) Q781R probably damaging Het
Pp2d1 T A 17: 53,815,318 (GRCm39) T469S possibly damaging Het
Sectm1a G A 11: 120,959,631 (GRCm39) L166F probably damaging Het
Sgms1 T A 19: 32,120,169 (GRCm39) M246L probably benign Het
Shroom3 G A 5: 93,098,806 (GRCm39) G1429S probably benign Het
Snx17 T A 5: 31,352,804 (GRCm39) F101Y probably damaging Het
Sowahb C T 5: 93,191,240 (GRCm39) S493N probably benign Het
Spc25 T A 2: 69,036,481 (GRCm39) R7S unknown Het
Sult2b1 A G 7: 45,379,620 (GRCm39) I308T probably benign Het
Tkt A G 14: 30,280,763 (GRCm39) N65D probably benign Het
Ttc5 A T 14: 51,010,769 (GRCm39) S221T probably benign Het
Ubr5 G A 15: 37,980,076 (GRCm39) A2434V probably null Het
Wipf1 A C 2: 73,274,805 (GRCm39) S55R probably damaging Het
Zdbf2 T C 1: 63,344,530 (GRCm39) S970P possibly damaging Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,706,067 (GRCm39) probably benign Het
Zfp362 A T 4: 128,671,203 (GRCm39) H313Q probably benign Het
Zfy2 T A Y: 2,121,420 (GRCm39) I158F probably benign Het
Other mutations in Ccdc162
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01013:Ccdc162 APN 10 41,457,335 (GRCm39) missense probably benign 0.01
IGL01366:Ccdc162 APN 10 41,456,302 (GRCm39) missense possibly damaging 0.49
IGL01924:Ccdc162 APN 10 41,445,883 (GRCm39) missense probably damaging 1.00
IGL02504:Ccdc162 APN 10 41,428,384 (GRCm39) missense probably damaging 1.00
IGL02678:Ccdc162 APN 10 41,437,151 (GRCm39) missense probably damaging 0.99
IGL02955:Ccdc162 APN 10 41,437,123 (GRCm39) missense probably damaging 1.00
beeswax UTSW 10 41,437,222 (GRCm39) missense possibly damaging 0.57
honeycomb UTSW 10 41,520,637 (GRCm39) missense probably benign 0.35
FR4304:Ccdc162 UTSW 10 41,432,117 (GRCm39) missense possibly damaging 0.49
R0432:Ccdc162 UTSW 10 41,417,856 (GRCm39) missense probably benign 0.01
R0585:Ccdc162 UTSW 10 41,462,375 (GRCm39) missense probably benign 0.03
R0645:Ccdc162 UTSW 10 41,462,407 (GRCm39) splice site probably benign
R0731:Ccdc162 UTSW 10 41,455,139 (GRCm39) missense probably damaging 1.00
R1426:Ccdc162 UTSW 10 41,429,178 (GRCm39) missense possibly damaging 0.89
R1447:Ccdc162 UTSW 10 41,456,243 (GRCm39) missense probably damaging 1.00
R1712:Ccdc162 UTSW 10 41,415,427 (GRCm39) missense probably benign 0.35
R2138:Ccdc162 UTSW 10 41,457,293 (GRCm39) missense probably benign 0.15
R2351:Ccdc162 UTSW 10 41,431,968 (GRCm39) critical splice donor site probably null
R2394:Ccdc162 UTSW 10 41,445,894 (GRCm39) missense probably damaging 1.00
R2431:Ccdc162 UTSW 10 41,445,841 (GRCm39) missense probably benign
R2571:Ccdc162 UTSW 10 41,428,393 (GRCm39) missense probably damaging 1.00
R2873:Ccdc162 UTSW 10 41,531,095 (GRCm39) missense possibly damaging 0.68
R2926:Ccdc162 UTSW 10 41,437,203 (GRCm39) start gained probably benign
R2999:Ccdc162 UTSW 10 41,456,286 (GRCm39) missense probably benign 0.00
R3412:Ccdc162 UTSW 10 41,415,545 (GRCm39) splice site probably benign
R3712:Ccdc162 UTSW 10 41,463,375 (GRCm39) missense probably benign
R3736:Ccdc162 UTSW 10 41,465,564 (GRCm39) splice site probably null
R4112:Ccdc162 UTSW 10 41,532,324 (GRCm39) missense possibly damaging 0.77
R4557:Ccdc162 UTSW 10 41,463,384 (GRCm39) missense probably benign 0.01
R4580:Ccdc162 UTSW 10 41,437,136 (GRCm39) missense probably benign 0.02
R4685:Ccdc162 UTSW 10 41,557,682 (GRCm39) missense possibly damaging 0.89
R4837:Ccdc162 UTSW 10 41,549,863 (GRCm39) missense probably benign 0.00
R5155:Ccdc162 UTSW 10 41,455,147 (GRCm39) missense probably damaging 1.00
R5155:Ccdc162 UTSW 10 41,429,576 (GRCm39) splice site probably null
R5645:Ccdc162 UTSW 10 41,428,352 (GRCm39) missense probably benign 0.06
R5656:Ccdc162 UTSW 10 41,445,930 (GRCm39) missense probably benign 0.26
R5682:Ccdc162 UTSW 10 41,432,799 (GRCm39) nonsense probably null
R5808:Ccdc162 UTSW 10 41,531,500 (GRCm39) missense possibly damaging 0.62
R5909:Ccdc162 UTSW 10 41,437,111 (GRCm39) missense probably damaging 1.00
R6000:Ccdc162 UTSW 10 41,437,159 (GRCm39) missense possibly damaging 0.75
R6057:Ccdc162 UTSW 10 41,510,037 (GRCm39) missense possibly damaging 0.72
R6211:Ccdc162 UTSW 10 41,506,141 (GRCm39) nonsense probably null
R6264:Ccdc162 UTSW 10 41,570,464 (GRCm39) missense probably benign 0.31
R6329:Ccdc162 UTSW 10 41,539,147 (GRCm39) missense possibly damaging 0.76
R6349:Ccdc162 UTSW 10 41,570,396 (GRCm39) missense probably damaging 0.97
R6398:Ccdc162 UTSW 10 41,503,145 (GRCm39) missense probably damaging 1.00
R6453:Ccdc162 UTSW 10 41,426,821 (GRCm39) missense probably damaging 1.00
R6602:Ccdc162 UTSW 10 41,491,976 (GRCm39) missense probably benign 0.00
R6627:Ccdc162 UTSW 10 41,539,181 (GRCm39) missense probably damaging 1.00
R6722:Ccdc162 UTSW 10 41,520,637 (GRCm39) missense probably benign 0.35
R6750:Ccdc162 UTSW 10 41,437,222 (GRCm39) missense possibly damaging 0.57
R6968:Ccdc162 UTSW 10 41,549,840 (GRCm39) missense possibly damaging 0.55
R6970:Ccdc162 UTSW 10 41,491,954 (GRCm39) missense probably benign 0.03
R6989:Ccdc162 UTSW 10 41,457,349 (GRCm39) missense probably damaging 0.99
R7008:Ccdc162 UTSW 10 41,428,411 (GRCm39) missense probably damaging 1.00
R7135:Ccdc162 UTSW 10 41,549,855 (GRCm39) missense probably benign 0.00
R7139:Ccdc162 UTSW 10 41,542,717 (GRCm39) missense possibly damaging 0.49
R7224:Ccdc162 UTSW 10 41,437,187 (GRCm39) missense probably damaging 1.00
R7230:Ccdc162 UTSW 10 41,554,809 (GRCm39) missense probably damaging 1.00
R7256:Ccdc162 UTSW 10 41,431,997 (GRCm39) missense probably damaging 0.99
R7261:Ccdc162 UTSW 10 41,437,136 (GRCm39) missense probably benign 0.02
R7390:Ccdc162 UTSW 10 41,510,044 (GRCm39) missense probably benign
R7726:Ccdc162 UTSW 10 41,429,071 (GRCm39) missense probably benign 0.00
R7754:Ccdc162 UTSW 10 41,463,371 (GRCm39) missense probably damaging 1.00
R7764:Ccdc162 UTSW 10 41,566,109 (GRCm39) missense possibly damaging 0.95
R8053:Ccdc162 UTSW 10 41,520,577 (GRCm39) missense probably benign
R8088:Ccdc162 UTSW 10 41,499,410 (GRCm39) missense possibly damaging 0.68
R8094:Ccdc162 UTSW 10 41,488,864 (GRCm39) missense probably benign 0.02
R8097:Ccdc162 UTSW 10 41,510,115 (GRCm39) missense probably benign 0.03
R8321:Ccdc162 UTSW 10 41,510,029 (GRCm39) missense probably damaging 0.98
R8377:Ccdc162 UTSW 10 41,457,306 (GRCm39) missense probably benign 0.08
R8399:Ccdc162 UTSW 10 41,415,517 (GRCm39) missense probably damaging 1.00
R8669:Ccdc162 UTSW 10 41,428,352 (GRCm39) missense probably benign 0.06
R8772:Ccdc162 UTSW 10 41,506,033 (GRCm39) missense probably damaging 0.99
R8810:Ccdc162 UTSW 10 41,542,737 (GRCm39) missense probably benign 0.41
R8903:Ccdc162 UTSW 10 41,531,440 (GRCm39) critical splice donor site probably null
R8928:Ccdc162 UTSW 10 41,462,245 (GRCm39) splice site probably benign
R8950:Ccdc162 UTSW 10 41,474,507 (GRCm39) missense probably benign 0.00
R8960:Ccdc162 UTSW 10 41,429,178 (GRCm39) missense probably damaging 0.96
R8985:Ccdc162 UTSW 10 41,432,102 (GRCm39) missense probably damaging 1.00
R9071:Ccdc162 UTSW 10 41,457,174 (GRCm39) nonsense probably null
R9254:Ccdc162 UTSW 10 41,488,944 (GRCm39) critical splice acceptor site probably null
R9297:Ccdc162 UTSW 10 41,506,110 (GRCm39) missense probably benign
R9318:Ccdc162 UTSW 10 41,506,110 (GRCm39) missense probably benign
R9518:Ccdc162 UTSW 10 41,465,572 (GRCm39) missense probably damaging 1.00
R9525:Ccdc162 UTSW 10 41,559,222 (GRCm39) missense probably damaging 0.99
R9539:Ccdc162 UTSW 10 41,463,407 (GRCm39) missense possibly damaging 0.54
R9638:Ccdc162 UTSW 10 41,437,159 (GRCm39) missense probably benign 0.01
Z1176:Ccdc162 UTSW 10 41,530,993 (GRCm39) missense possibly damaging 0.84
Z1176:Ccdc162 UTSW 10 41,481,104 (GRCm39) missense possibly damaging 0.84
Z1176:Ccdc162 UTSW 10 41,429,127 (GRCm39) missense probably benign 0.00
Z1176:Ccdc162 UTSW 10 41,566,088 (GRCm39) missense probably benign 0.00
Z1177:Ccdc162 UTSW 10 41,559,191 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TACACCTAAGGAGTAAGGCCCG -3'
(R):5'- TTTGCTTAATACAGGGCCTGCTC -3'

Sequencing Primer
(F):5'- GACTGCACTTGCTATCCAGTGG -3'
(R):5'- AGGGCCTGCTCTGGTTCAG -3'
Posted On 2019-11-12