Mutagenetix > Incidental Mutations

Incidental Mutation 'R7712:Pdzd2'

594704

Institutional Source

Beutler Lab

Gene Symbol

Pdzd2

Ensembl Gene

ENSMUSG00000022197

Gene Name

PDZ domain containing 2

Synonyms

Pdzk3, A930022H17Rik, 4930537L06Rik, Gm21706, LOC223364

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.135) question?

Stock #

R7712 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

12359711-12739924 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 12407336 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Asparagine at position 346 (T346N)

Ref Sequence

ENSEMBL: ENSMUSP00000140682 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075317] [ENSMUST00000190929]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000075317
AA Change: T572N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000074788
Gene: ENSMUSG00000022197
AA Change: T572N

Domain	Start	End	E-Value	Type
PDZ	81	179	1.27e-2	SMART
PDZ	342	419	1.51e-18	SMART
PDZ	597	675	5.25e-18	SMART
low complexity region	690	718	N/A	INTRINSIC
PDZ	738	817	1.64e-10	SMART
low complexity region	861	869	N/A	INTRINSIC
low complexity region	969	984	N/A	INTRINSIC
low complexity region	986	1000	N/A	INTRINSIC
low complexity region	1436	1459	N/A	INTRINSIC
low complexity region	1525	1537	N/A	INTRINSIC
low complexity region	1538	1553	N/A	INTRINSIC
low complexity region	1567	1586	N/A	INTRINSIC
low complexity region	2111	2129	N/A	INTRINSIC
low complexity region	2190	2198	N/A	INTRINSIC
low complexity region	2335	2354	N/A	INTRINSIC
low complexity region	2469	2479	N/A	INTRINSIC
PDZ	2589	2666	1.3e-13	SMART
PDZ	2716	2794	9.42e-20	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000190929
AA Change: T346N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000140682
Gene: ENSMUSG00000022197
AA Change: T346N

Domain	Start	End	E-Value	Type
PDZ	168	245	3e-20	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains six PDZ domains and shares sequence similarity with pro-interleukin-16 (pro-IL-16). Like pro-IL-16, the encoded protein localizes to the endoplasmic reticulum and is thought to be cleaved by a caspase to produce a secreted peptide containing two PDZ domains. In addition, this gene is upregulated in primary prostate tumors and may be involved in the early stages of prostate tumorigenesis. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit normal response to acute and chronic pain. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acacb	A	C	5: 114,165,738	D74A	probably benign	Het
Alox15	T	C	11: 70,350,253		probably null	Het
Ano5	A	G	7: 51,573,057	T455A	probably benign	Het
Ano5	T	G	7: 51,590,655	I827S	probably damaging	Het
Arid1a	G	A	4: 133,752,611	A334V	probably benign	Het
Atp13a4	A	G	16: 29,459,487	C298R		Het
Atp4a	T	A	7: 30,715,553	S256T	probably damaging	Het
Atp6v1c1	G	A	15: 38,686,805	V215I	probably benign	Het
Bbs9	T	A	9: 22,670,813	F600L	probably benign	Het
Bmp8b	A	T	4: 123,124,464	Y376F	possibly damaging	Het
Cacna2d1	A	T	5: 16,362,349	D986V	probably damaging	Het
Ccdc162	A	G	10: 41,627,227	F973S	possibly damaging	Het
Ccdc177	G	A	12: 80,757,938	Q521*	probably null	Het
Cd209b	T	A	8: 3,923,299	E158D	possibly damaging	Het
Cdk14	G	A	5: 5,380,061	T22I	possibly damaging	Het
Chl1	A	T	6: 103,711,102	I968F	possibly damaging	Het
Cnot7	T	C	8: 40,494,081	Y255C	probably damaging	Het
Col4a2	T	A	8: 11,425,376	L600H	probably benign	Het
Cpne7	C	A	8: 123,124,181	L129M	probably damaging	Het
Cpxm2	G	T	7: 132,154,378	P79Q	possibly damaging	Het
Dhx9	T	A	1: 153,465,001	N631I	probably benign	Het
Dmxl1	T	C	18: 49,893,461	S1879P	probably damaging	Het
Dnhd1	T	A	7: 105,651,624	F63I	probably benign	Het
Dok7	A	G	5: 35,066,522	N98S	probably damaging	Het
Fgd2	A	G	17: 29,376,912	T515A	probably benign	Het
Fmo1	T	C	1: 162,836,135	D275G	probably benign	Het
Gm5796	A	G	14: 4,034,759	Y90C	probably damaging	Het
H60b	C	A	10: 22,285,738	H42N	possibly damaging	Het
Hipk2	A	G	6: 38,703,634	S924P	probably benign	Het
Hpf1	C	A	8: 60,905,579	S27*	probably null	Het
Idua	T	G	5: 108,681,522	D443E	probably benign	Het
Lamc2	C	T	1: 153,133,611	G816D	possibly damaging	Het
Lgi3	T	A	14: 70,531,111	V16E	unknown	Het
Lpar1	T	A	4: 58,486,795	M159L	probably benign	Het
Magi2	A	G	5: 20,550,282	D618G	possibly damaging	Het
Man2b2	C	G	5: 36,810,314	Q903H	probably benign	Het
March7	A	T	2: 60,234,990	K537*	probably null	Het
Mcoln1	T	C	8: 3,505,873	F56S	probably damaging	Het
Myh7	C	G	14: 54,988,801	D461H	probably damaging	Het
Myo1b	A	T	1: 51,793,677	M383K	probably damaging	Het
Olfr160	T	C	9: 37,712,133	I49V	probably damaging	Het
Olfr161	T	C	16: 3,592,431	F12L	probably damaging	Het
Olfr360	A	T	2: 37,068,904	T200S	probably damaging	Het
Pars2	T	A	4: 106,654,079	Y353N	probably damaging	Het
Pcdha8	A	C	18: 36,992,684	D73A	possibly damaging	Het
Pcdhga8	C	T	18: 37,727,049	T386M	possibly damaging	Het
Pik3c2b	A	G	1: 133,085,611	Q781R	probably damaging	Het
Pp2d1	T	A	17: 53,508,290	T469S	possibly damaging	Het
Sectm1a	G	A	11: 121,068,805	L166F	probably damaging	Het
Sgms1	T	A	19: 32,142,769	M246L	probably benign	Het
Shroom3	G	A	5: 92,950,947	G1429S	probably benign	Het
Snx17	T	A	5: 31,195,460	F101Y	probably damaging	Het
Sowahb	C	T	5: 93,043,381	S493N	probably benign	Het
Spc25	T	A	2: 69,206,137	R7S	unknown	Het
Sult2b1	A	G	7: 45,730,196	I308T	probably benign	Het
Tkt	A	G	14: 30,558,806	N65D	probably benign	Het
Ttc5	A	T	14: 50,773,312	S221T	probably benign	Het
Ubr5	G	A	15: 37,979,832	A2434V	probably null	Het
Wipf1	A	C	2: 73,444,461	S55R	probably damaging	Het
Zdbf2	T	C	1: 63,305,371	S970P	possibly damaging	Het
Zfp354c	TCACACTCGGCACA	TCACA	11: 50,815,240		probably benign	Het
Zfp362	A	T	4: 128,777,410	H313Q	probably benign	Het
Zfy2	T	A	Y: 2,121,420	I158F	probably benign	Het

Other mutations in Pdzd2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00159:Pdzd2	APN	15	12457983	missense	possibly damaging	0.93
IGL00586:Pdzd2	APN	15	12365767	splice site	probably null
IGL00697:Pdzd2	APN	15	12373647	missense	possibly damaging	0.81
IGL00721:Pdzd2	APN	15	12374412	missense	probably benign	0.00
IGL00971:Pdzd2	APN	15	12374718	missense	probably benign	0.00
IGL01066:Pdzd2	APN	15	12402632	unclassified	probably benign
IGL01389:Pdzd2	APN	15	12374626	missense	possibly damaging	0.56
IGL01505:Pdzd2	APN	15	12458207	missense	probably damaging	1.00
IGL01527:Pdzd2	APN	15	12445664	missense	probably damaging	1.00
IGL01584:Pdzd2	APN	15	12592483	missense	probably damaging	1.00
IGL01763:Pdzd2	APN	15	12372546	missense	probably benign
IGL01915:Pdzd2	APN	15	12371639	missense	probably damaging	1.00
IGL01947:Pdzd2	APN	15	12592354	missense	probably damaging	1.00
IGL02058:Pdzd2	APN	15	12376296	missense	possibly damaging	0.87
IGL02274:Pdzd2	APN	15	12445649	missense	probably damaging	1.00
IGL02408:Pdzd2	APN	15	12375765	missense	probably benign	0.00
IGL02600:Pdzd2	APN	15	12411019	missense	probably damaging	1.00
IGL02637:Pdzd2	APN	15	12385634	missense	probably benign	0.13
IGL02639:Pdzd2	APN	15	12592243	missense	probably damaging	1.00
IGL02712:Pdzd2	APN	15	12376027	missense	probably benign	0.00
IGL02967:Pdzd2	APN	15	12374341	missense	probably benign	0.04
IGL02992:Pdzd2	APN	15	12382622	missense	possibly damaging	0.77
IGL03005:Pdzd2	APN	15	12385265	missense	probably damaging	1.00
IGL03067:Pdzd2	APN	15	12388542	critical splice donor site	probably null
IGL03335:Pdzd2	APN	15	12373764	missense	probably benign	0.00
PIT4280001:Pdzd2	UTSW	15	12399288	missense	probably damaging	1.00
R0022:Pdzd2	UTSW	15	12371605	missense	possibly damaging	0.94
R0241:Pdzd2	UTSW	15	12367941	missense	probably damaging	1.00
R0241:Pdzd2	UTSW	15	12367941	missense	probably damaging	1.00
R0446:Pdzd2	UTSW	15	12375024	missense	probably benign	0.43
R0462:Pdzd2	UTSW	15	12592160	missense	probably damaging	1.00
R0562:Pdzd2	UTSW	15	12592278	missense	probably damaging	1.00
R0589:Pdzd2	UTSW	15	12376299	missense	probably benign	0.03
R0639:Pdzd2	UTSW	15	12458058	missense	possibly damaging	0.77
R0925:Pdzd2	UTSW	15	12399270	missense	probably damaging	1.00
R1015:Pdzd2	UTSW	15	12374508	missense	probably damaging	1.00
R1054:Pdzd2	UTSW	15	12371639	missense	probably damaging	1.00
R1070:Pdzd2	UTSW	15	12389966	critical splice donor site	probably null
R1099:Pdzd2	UTSW	15	12373087	missense	probably damaging	1.00
R1122:Pdzd2	UTSW	15	12457895	missense	probably benign	0.25
R1126:Pdzd2	UTSW	15	12458220	missense	possibly damaging	0.94
R1381:Pdzd2	UTSW	15	12385439	missense	probably benign	0.02
R1385:Pdzd2	UTSW	15	12411022	missense	probably benign	0.38
R1513:Pdzd2	UTSW	15	12373829	missense	possibly damaging	0.88
R1538:Pdzd2	UTSW	15	12372961	missense	probably damaging	1.00
R1750:Pdzd2	UTSW	15	12385864	missense	probably damaging	1.00
R1775:Pdzd2	UTSW	15	12592460	missense	probably damaging	1.00
R1801:Pdzd2	UTSW	15	12387654	missense	possibly damaging	0.56
R1832:Pdzd2	UTSW	15	12390048	missense	probably damaging	1.00
R1856:Pdzd2	UTSW	15	12373855	missense	possibly damaging	0.87
R1870:Pdzd2	UTSW	15	12457886	missense	probably damaging	1.00
R1879:Pdzd2	UTSW	15	12373900	missense	possibly damaging	0.61
R2072:Pdzd2	UTSW	15	12385819	missense	probably damaging	1.00
R2073:Pdzd2	UTSW	15	12385819	missense	probably damaging	1.00
R2075:Pdzd2	UTSW	15	12385819	missense	probably damaging	1.00
R2125:Pdzd2	UTSW	15	12373590	missense	probably benign	0.37
R2142:Pdzd2	UTSW	15	12406559	missense	probably damaging	1.00
R2155:Pdzd2	UTSW	15	12375793	missense	probably benign	0.43
R2282:Pdzd2	UTSW	15	12373848	missense	possibly damaging	0.95
R2407:Pdzd2	UTSW	15	12373161	missense	probably damaging	1.00
R3545:Pdzd2	UTSW	15	12375471	missense	probably benign	0.00
R3878:Pdzd2	UTSW	15	12376176	missense	probably benign	0.00
R3879:Pdzd2	UTSW	15	12375508	missense	probably damaging	1.00
R4396:Pdzd2	UTSW	15	12387646	missense	probably benign	0.36
R4398:Pdzd2	UTSW	15	12375975	missense	probably benign	0.30
R4491:Pdzd2	UTSW	15	12385637	missense	possibly damaging	0.75
R4492:Pdzd2	UTSW	15	12385637	missense	possibly damaging	0.75
R4492:Pdzd2	UTSW	15	12419481	missense	possibly damaging	0.48
R4656:Pdzd2	UTSW	15	12385711	missense	probably benign	0.00
R4715:Pdzd2	UTSW	15	12419516	missense	possibly damaging	0.72
R4803:Pdzd2	UTSW	15	12374595	missense	probably benign	0.04
R4893:Pdzd2	UTSW	15	12385343	missense	probably benign	0.00
R4959:Pdzd2	UTSW	15	12375648	missense	probably damaging	1.00
R4973:Pdzd2	UTSW	15	12375648	missense	probably damaging	1.00
R5030:Pdzd2	UTSW	15	12592408	nonsense	probably null
R5174:Pdzd2	UTSW	15	12372514	missense	probably benign	0.01
R5230:Pdzd2	UTSW	15	12390033	missense	probably damaging	1.00
R5256:Pdzd2	UTSW	15	12372942	missense	possibly damaging	0.87
R5268:Pdzd2	UTSW	15	12592177	missense	probably damaging	1.00
R5488:Pdzd2	UTSW	15	12382676	missense	probably benign	0.00
R5489:Pdzd2	UTSW	15	12382676	missense	probably benign	0.00
R5588:Pdzd2	UTSW	15	12374281	missense	possibly damaging	0.48
R5605:Pdzd2	UTSW	15	12592350	nonsense	probably null
R5704:Pdzd2	UTSW	15	12385675	missense	probably benign	0.02
R5858:Pdzd2	UTSW	15	12442589	missense	probably damaging	0.97
R6048:Pdzd2	UTSW	15	12592570	splice site	probably null
R6222:Pdzd2	UTSW	15	12374566	missense	probably damaging	1.00
R6311:Pdzd2	UTSW	15	12458188	missense	probably damaging	1.00
R6734:Pdzd2	UTSW	15	12592465	missense	probably damaging	1.00
R6897:Pdzd2	UTSW	15	12385865	missense	probably damaging	1.00
R6900:Pdzd2	UTSW	15	12374037	missense	probably benign
R6955:Pdzd2	UTSW	15	12401464	missense	probably damaging	1.00
R6959:Pdzd2	UTSW	15	12375907	missense	probably benign	0.17
R6992:Pdzd2	UTSW	15	12457859	missense	probably damaging	1.00
R7014:Pdzd2	UTSW	15	12372561	missense	probably benign	0.13
R7014:Pdzd2	UTSW	15	12372975	missense	probably benign	0.14
R7110:Pdzd2	UTSW	15	12368013	missense	probably damaging	1.00
R7180:Pdzd2	UTSW	15	12376123	missense	probably damaging	0.99
R7228:Pdzd2	UTSW	15	12372973	missense	probably benign	0.01
R7228:Pdzd2	UTSW	15	12458145	nonsense	probably null
R7317:Pdzd2	UTSW	15	12592243	missense	probably damaging	1.00
R7322:Pdzd2	UTSW	15	12437162	missense	probably damaging	1.00
R7349:Pdzd2	UTSW	15	12399205	missense	probably damaging	1.00
R7600:Pdzd2	UTSW	15	12372734	missense	probably damaging	1.00
R7663:Pdzd2	UTSW	15	12373203	missense	probably damaging	1.00
R7716:Pdzd2	UTSW	15	12373374	missense	possibly damaging	0.63
R7740:Pdzd2	UTSW	15	12374016	missense	probably benign	0.00
R7748:Pdzd2	UTSW	15	12385786	missense	possibly damaging	0.60
R8017:Pdzd2	UTSW	15	12373036	missense	probably damaging	1.00
R8019:Pdzd2	UTSW	15	12373036	missense	probably damaging	1.00
R8108:Pdzd2	UTSW	15	12373506	missense	probably benign	0.01
R8109:Pdzd2	UTSW	15	12373506	missense	probably benign	0.01
R8110:Pdzd2	UTSW	15	12373506	missense	probably benign	0.01
R8111:Pdzd2	UTSW	15	12373506	missense	probably benign	0.01
R8145:Pdzd2	UTSW	15	12407372	missense	probably benign	0.37
R8220:Pdzd2	UTSW	15	12592163	missense	probably damaging	0.99
R8278:Pdzd2	UTSW	15	12375909	missense	probably benign
R8768:Pdzd2	UTSW	15	12437166	missense	probably damaging	1.00
R8879:Pdzd2	UTSW	15	12402319	missense	probably damaging	1.00
R9019:Pdzd2	UTSW	15	12375526	missense	probably damaging	1.00
R9030:Pdzd2	UTSW	15	12374299	missense	probably benign	0.02
R9061:Pdzd2	UTSW	15	12374667	missense	possibly damaging	0.94
R9302:Pdzd2	UTSW	15	12374256	missense	possibly damaging	0.61
R9321:Pdzd2	UTSW	15	12385937	missense	probably benign	0.00
R9421:Pdzd2	UTSW	15	12375028	missense
X0057:Pdzd2	UTSW	15	12411027	missense	probably damaging	1.00
X0063:Pdzd2	UTSW	15	12368719	missense	possibly damaging	0.77
X0066:Pdzd2	UTSW	15	12372856	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GGGGATCATTTCTTCCACTCTG -3'
(R):5'- TGTTCTCTTAAGCCAGTGGG -3'

Sequencing Primer
(F):5'- TCTGGTATATATTATCCCTTTCCACG -3'
(R):5'- CCAGTGGGCCACAGATG -3'

Posted On

2019-11-12