Incidental Mutation 'R7712:Pdzd2'
ID594704
Institutional Source Beutler Lab
Gene Symbol Pdzd2
Ensembl Gene ENSMUSG00000022197
Gene NamePDZ domain containing 2
SynonymsPdzk3, A930022H17Rik, 4930537L06Rik, Gm21706, LOC223364
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.182) question?
Stock #R7712 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location12359711-12739924 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 12407336 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Asparagine at position 346 (T346N)
Ref Sequence ENSEMBL: ENSMUSP00000140682 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075317] [ENSMUST00000190929]
Predicted Effect probably damaging
Transcript: ENSMUST00000075317
AA Change: T572N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074788
Gene: ENSMUSG00000022197
AA Change: T572N

DomainStartEndE-ValueType
PDZ 81 179 1.27e-2 SMART
PDZ 342 419 1.51e-18 SMART
PDZ 597 675 5.25e-18 SMART
low complexity region 690 718 N/A INTRINSIC
PDZ 738 817 1.64e-10 SMART
low complexity region 861 869 N/A INTRINSIC
low complexity region 969 984 N/A INTRINSIC
low complexity region 986 1000 N/A INTRINSIC
low complexity region 1436 1459 N/A INTRINSIC
low complexity region 1525 1537 N/A INTRINSIC
low complexity region 1538 1553 N/A INTRINSIC
low complexity region 1567 1586 N/A INTRINSIC
low complexity region 2111 2129 N/A INTRINSIC
low complexity region 2190 2198 N/A INTRINSIC
low complexity region 2335 2354 N/A INTRINSIC
low complexity region 2469 2479 N/A INTRINSIC
PDZ 2589 2666 1.3e-13 SMART
PDZ 2716 2794 9.42e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000190929
AA Change: T346N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140682
Gene: ENSMUSG00000022197
AA Change: T346N

DomainStartEndE-ValueType
PDZ 168 245 3e-20 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains six PDZ domains and shares sequence similarity with pro-interleukin-16 (pro-IL-16). Like pro-IL-16, the encoded protein localizes to the endoplasmic reticulum and is thought to be cleaved by a caspase to produce a secreted peptide containing two PDZ domains. In addition, this gene is upregulated in primary prostate tumors and may be involved in the early stages of prostate tumorigenesis. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit normal response to acute and chronic pain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb A C 5: 114,165,738 D74A probably benign Het
Alox15 T C 11: 70,350,253 probably null Het
Ano5 A G 7: 51,573,057 T455A probably benign Het
Ano5 T G 7: 51,590,655 I827S probably damaging Het
Arid1a G A 4: 133,752,611 A334V probably benign Het
Atp13a4 A G 16: 29,459,487 C298R Het
Atp4a T A 7: 30,715,553 S256T probably damaging Het
Atp6v1c1 G A 15: 38,686,805 V215I probably benign Het
Bbs9 T A 9: 22,670,813 F600L probably benign Het
Bmp8b A T 4: 123,124,464 Y376F possibly damaging Het
Cacna2d1 A T 5: 16,362,349 D986V probably damaging Het
Ccdc162 A G 10: 41,627,227 F973S possibly damaging Het
Ccdc177 G A 12: 80,757,938 Q521* probably null Het
Cd209b T A 8: 3,923,299 E158D possibly damaging Het
Cdk14 G A 5: 5,380,061 T22I possibly damaging Het
Chl1 A T 6: 103,711,102 I968F possibly damaging Het
Cnot7 T C 8: 40,494,081 Y255C probably damaging Het
Col4a2 T A 8: 11,425,376 L600H probably benign Het
Cpne7 C A 8: 123,124,181 L129M probably damaging Het
Cpxm2 G T 7: 132,154,378 P79Q possibly damaging Het
Dhx9 T A 1: 153,465,001 N631I probably benign Het
Dmxl1 T C 18: 49,893,461 S1879P probably damaging Het
Dnhd1 T A 7: 105,651,624 F63I probably benign Het
Dok7 A G 5: 35,066,522 N98S probably damaging Het
Fgd2 A G 17: 29,376,912 T515A probably benign Het
Fmo1 T C 1: 162,836,135 D275G probably benign Het
Gm5796 A G 14: 4,034,759 Y90C probably damaging Het
H60b C A 10: 22,285,738 H42N possibly damaging Het
Hipk2 A G 6: 38,703,634 S924P probably benign Het
Hpf1 C A 8: 60,905,579 S27* probably null Het
Idua T G 5: 108,681,522 D443E probably benign Het
Lamc2 C T 1: 153,133,611 G816D possibly damaging Het
Lgi3 T A 14: 70,531,111 V16E unknown Het
Lpar1 T A 4: 58,486,795 M159L probably benign Het
Magi2 A G 5: 20,550,282 D618G possibly damaging Het
Man2b2 C G 5: 36,810,314 Q903H probably benign Het
March7 A T 2: 60,234,990 K537* probably null Het
Mcoln1 T C 8: 3,505,873 F56S probably damaging Het
Myh7 C G 14: 54,988,801 D461H probably damaging Het
Myo1b A T 1: 51,793,677 M383K probably damaging Het
Olfr160 T C 9: 37,712,133 I49V probably damaging Het
Olfr161 T C 16: 3,592,431 F12L probably damaging Het
Olfr360 A T 2: 37,068,904 T200S probably damaging Het
Pars2 T A 4: 106,654,079 Y353N probably damaging Het
Pcdha8 A C 18: 36,992,684 D73A possibly damaging Het
Pcdhga8 C T 18: 37,727,049 T386M possibly damaging Het
Pik3c2b A G 1: 133,085,611 Q781R probably damaging Het
Pp2d1 T A 17: 53,508,290 T469S possibly damaging Het
Sectm1a G A 11: 121,068,805 L166F probably damaging Het
Sgms1 T A 19: 32,142,769 M246L probably benign Het
Shroom3 G A 5: 92,950,947 G1429S probably benign Het
Snx17 T A 5: 31,195,460 F101Y probably damaging Het
Sowahb C T 5: 93,043,381 S493N probably benign Het
Spc25 T A 2: 69,206,137 R7S unknown Het
Sult2b1 A G 7: 45,730,196 I308T probably benign Het
Tkt A G 14: 30,558,806 N65D probably benign Het
Ttc5 A T 14: 50,773,312 S221T probably benign Het
Ubr5 G A 15: 37,979,832 A2434V probably null Het
Wipf1 A C 2: 73,444,461 S55R probably damaging Het
Zdbf2 T C 1: 63,305,371 S970P possibly damaging Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,815,240 probably benign Het
Zfp362 A T 4: 128,777,410 H313Q probably benign Het
Zfy2 T A Y: 2,121,420 I158F probably benign Het
Other mutations in Pdzd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Pdzd2 APN 15 12457983 missense possibly damaging 0.93
IGL00586:Pdzd2 APN 15 12365767 splice site probably null
IGL00697:Pdzd2 APN 15 12373647 missense possibly damaging 0.81
IGL00721:Pdzd2 APN 15 12374412 missense probably benign 0.00
IGL00971:Pdzd2 APN 15 12374718 missense probably benign 0.00
IGL01066:Pdzd2 APN 15 12402632 unclassified probably benign
IGL01389:Pdzd2 APN 15 12374626 missense possibly damaging 0.56
IGL01505:Pdzd2 APN 15 12458207 missense probably damaging 1.00
IGL01527:Pdzd2 APN 15 12445664 missense probably damaging 1.00
IGL01584:Pdzd2 APN 15 12592483 missense probably damaging 1.00
IGL01763:Pdzd2 APN 15 12372546 missense probably benign
IGL01915:Pdzd2 APN 15 12371639 missense probably damaging 1.00
IGL01947:Pdzd2 APN 15 12592354 missense probably damaging 1.00
IGL02058:Pdzd2 APN 15 12376296 missense possibly damaging 0.87
IGL02274:Pdzd2 APN 15 12445649 missense probably damaging 1.00
IGL02408:Pdzd2 APN 15 12375765 missense probably benign 0.00
IGL02600:Pdzd2 APN 15 12411019 missense probably damaging 1.00
IGL02637:Pdzd2 APN 15 12385634 missense probably benign 0.13
IGL02639:Pdzd2 APN 15 12592243 missense probably damaging 1.00
IGL02712:Pdzd2 APN 15 12376027 missense probably benign 0.00
IGL02967:Pdzd2 APN 15 12374341 missense probably benign 0.04
IGL02992:Pdzd2 APN 15 12382622 missense possibly damaging 0.77
IGL03005:Pdzd2 APN 15 12385265 missense probably damaging 1.00
IGL03067:Pdzd2 APN 15 12388542 critical splice donor site probably null
IGL03335:Pdzd2 APN 15 12373764 missense probably benign 0.00
PIT4280001:Pdzd2 UTSW 15 12399288 missense probably damaging 1.00
R0022:Pdzd2 UTSW 15 12371605 missense possibly damaging 0.94
R0241:Pdzd2 UTSW 15 12367941 missense probably damaging 1.00
R0241:Pdzd2 UTSW 15 12367941 missense probably damaging 1.00
R0446:Pdzd2 UTSW 15 12375024 missense probably benign 0.43
R0462:Pdzd2 UTSW 15 12592160 missense probably damaging 1.00
R0562:Pdzd2 UTSW 15 12592278 missense probably damaging 1.00
R0589:Pdzd2 UTSW 15 12376299 missense probably benign 0.03
R0639:Pdzd2 UTSW 15 12458058 missense possibly damaging 0.77
R0925:Pdzd2 UTSW 15 12399270 missense probably damaging 1.00
R1015:Pdzd2 UTSW 15 12374508 missense probably damaging 1.00
R1054:Pdzd2 UTSW 15 12371639 missense probably damaging 1.00
R1070:Pdzd2 UTSW 15 12389966 critical splice donor site probably null
R1099:Pdzd2 UTSW 15 12373087 missense probably damaging 1.00
R1122:Pdzd2 UTSW 15 12457895 missense probably benign 0.25
R1126:Pdzd2 UTSW 15 12458220 missense possibly damaging 0.94
R1381:Pdzd2 UTSW 15 12385439 missense probably benign 0.02
R1385:Pdzd2 UTSW 15 12411022 missense probably benign 0.38
R1513:Pdzd2 UTSW 15 12373829 missense possibly damaging 0.88
R1538:Pdzd2 UTSW 15 12372961 missense probably damaging 1.00
R1750:Pdzd2 UTSW 15 12385864 missense probably damaging 1.00
R1775:Pdzd2 UTSW 15 12592460 missense probably damaging 1.00
R1801:Pdzd2 UTSW 15 12387654 missense possibly damaging 0.56
R1832:Pdzd2 UTSW 15 12390048 missense probably damaging 1.00
R1856:Pdzd2 UTSW 15 12373855 missense possibly damaging 0.87
R1870:Pdzd2 UTSW 15 12457886 missense probably damaging 1.00
R1879:Pdzd2 UTSW 15 12373900 missense possibly damaging 0.61
R2072:Pdzd2 UTSW 15 12385819 missense probably damaging 1.00
R2073:Pdzd2 UTSW 15 12385819 missense probably damaging 1.00
R2075:Pdzd2 UTSW 15 12385819 missense probably damaging 1.00
R2125:Pdzd2 UTSW 15 12373590 missense probably benign 0.37
R2142:Pdzd2 UTSW 15 12406559 missense probably damaging 1.00
R2155:Pdzd2 UTSW 15 12375793 missense probably benign 0.43
R2282:Pdzd2 UTSW 15 12373848 missense possibly damaging 0.95
R2407:Pdzd2 UTSW 15 12373161 missense probably damaging 1.00
R3545:Pdzd2 UTSW 15 12375471 missense probably benign 0.00
R3878:Pdzd2 UTSW 15 12376176 missense probably benign 0.00
R3879:Pdzd2 UTSW 15 12375508 missense probably damaging 1.00
R4396:Pdzd2 UTSW 15 12387646 missense probably benign 0.36
R4398:Pdzd2 UTSW 15 12375975 missense probably benign 0.30
R4491:Pdzd2 UTSW 15 12385637 missense possibly damaging 0.75
R4492:Pdzd2 UTSW 15 12385637 missense possibly damaging 0.75
R4492:Pdzd2 UTSW 15 12419481 missense possibly damaging 0.48
R4656:Pdzd2 UTSW 15 12385711 missense probably benign 0.00
R4715:Pdzd2 UTSW 15 12419516 missense possibly damaging 0.72
R4803:Pdzd2 UTSW 15 12374595 missense probably benign 0.04
R4893:Pdzd2 UTSW 15 12385343 missense probably benign 0.00
R4959:Pdzd2 UTSW 15 12375648 missense probably damaging 1.00
R4973:Pdzd2 UTSW 15 12375648 missense probably damaging 1.00
R5030:Pdzd2 UTSW 15 12592408 nonsense probably null
R5174:Pdzd2 UTSW 15 12372514 missense probably benign 0.01
R5230:Pdzd2 UTSW 15 12390033 missense probably damaging 1.00
R5256:Pdzd2 UTSW 15 12372942 missense possibly damaging 0.87
R5268:Pdzd2 UTSW 15 12592177 missense probably damaging 1.00
R5488:Pdzd2 UTSW 15 12382676 missense probably benign 0.00
R5489:Pdzd2 UTSW 15 12382676 missense probably benign 0.00
R5588:Pdzd2 UTSW 15 12374281 missense possibly damaging 0.48
R5605:Pdzd2 UTSW 15 12592350 nonsense probably null
R5704:Pdzd2 UTSW 15 12385675 missense probably benign 0.02
R5858:Pdzd2 UTSW 15 12442589 missense probably damaging 0.97
R6048:Pdzd2 UTSW 15 12592570 unclassified probably null
R6222:Pdzd2 UTSW 15 12374566 missense probably damaging 1.00
R6311:Pdzd2 UTSW 15 12458188 missense probably damaging 1.00
R6734:Pdzd2 UTSW 15 12592465 missense probably damaging 1.00
R6897:Pdzd2 UTSW 15 12385865 missense probably damaging 1.00
R6900:Pdzd2 UTSW 15 12374037 missense probably benign
R6955:Pdzd2 UTSW 15 12401464 missense probably damaging 1.00
R6959:Pdzd2 UTSW 15 12375907 missense probably benign 0.17
R6992:Pdzd2 UTSW 15 12457859 missense probably damaging 1.00
R7014:Pdzd2 UTSW 15 12372561 missense probably benign 0.13
R7014:Pdzd2 UTSW 15 12372975 missense probably benign 0.14
R7110:Pdzd2 UTSW 15 12368013 missense probably damaging 1.00
R7180:Pdzd2 UTSW 15 12376123 missense probably damaging 0.99
R7228:Pdzd2 UTSW 15 12372973 missense probably benign 0.01
R7228:Pdzd2 UTSW 15 12458145 nonsense probably null
R7317:Pdzd2 UTSW 15 12592243 missense probably damaging 1.00
R7322:Pdzd2 UTSW 15 12437162 missense probably damaging 1.00
R7349:Pdzd2 UTSW 15 12399205 missense probably damaging 1.00
R7600:Pdzd2 UTSW 15 12372734 missense probably damaging 1.00
R7663:Pdzd2 UTSW 15 12373203 missense probably damaging 1.00
R7716:Pdzd2 UTSW 15 12373374 missense possibly damaging 0.63
R7740:Pdzd2 UTSW 15 12374016 missense probably benign 0.00
R7748:Pdzd2 UTSW 15 12385786 missense possibly damaging 0.60
R8019:Pdzd2 UTSW 15 12373036 missense probably damaging 1.00
X0057:Pdzd2 UTSW 15 12411027 missense probably damaging 1.00
X0063:Pdzd2 UTSW 15 12368719 missense possibly damaging 0.77
X0066:Pdzd2 UTSW 15 12372856 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGGGATCATTTCTTCCACTCTG -3'
(R):5'- TGTTCTCTTAAGCCAGTGGG -3'

Sequencing Primer
(F):5'- TCTGGTATATATTATCCCTTTCCACG -3'
(R):5'- CCAGTGGGCCACAGATG -3'
Posted On2019-11-12