Incidental Mutation 'R7713:Yars'
ID594725
Institutional Source Beutler Lab
Gene Symbol Yars
Ensembl Gene ENSMUSG00000028811
Gene Nametyrosyl-tRNA synthetase
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7713 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location129189760-129219607 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 129210498 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 312 (V312L)
Ref Sequence ENSEMBL: ENSMUSP00000101669 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106054]
Predicted Effect probably benign
Transcript: ENSMUST00000106054
AA Change: V312L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000101669
Gene: ENSMUSG00000028811
AA Change: V312L

DomainStartEndE-ValueType
low complexity region 5 26 N/A INTRINSIC
Pfam:tRNA-synt_1b 67 358 1e-78 PFAM
Pfam:tRNA_bind 406 502 7.1e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133992
SMART Domains Protein: ENSMUSP00000118512
Gene: ENSMUSG00000028811

DomainStartEndE-ValueType
Pfam:tRNA-synt_1b 1 75 2.3e-11 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aminoacyl-tRNA synthetases catalyze the aminoacylation of tRNA by their cognate amino acid. Because of their central role in linking amino acids with nucleotide triplets contained in tRNAs, aminoacyl-tRNA synthetases are thought to be among the first proteins that appeared in evolution. Tyrosyl-tRNA synthetase belongs to the class I tRNA synthetase family. Cytokine activities have also been observed for the human tyrosyl-tRNA synthetase, after it is split into two parts, an N-terminal fragment that harbors the catalytic site and a C-terminal fragment found only in the mammalian enzyme. The N-terminal fragment is an interleukin-8-like cytokine, whereas the released C-terminal fragment is an EMAP II-like cytokine. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik T C 10: 87,230,311 S119P possibly damaging Het
Agtpbp1 T A 13: 59,514,152 I282F probably damaging Het
Armh1 A T 4: 117,214,228 M355K possibly damaging Het
BC067074 T G 13: 113,346,541 V1559G Het
Cep128 A T 12: 91,019,322 D1013E probably benign Het
Clock A T 5: 76,245,420 probably null Het
D630003M21Rik G A 2: 158,216,778 Q401* probably null Het
Dnah17 C A 11: 118,025,171 V4302L probably benign Het
Drc3 A G 11: 60,370,560 Y179C probably benign Het
Erbb3 T C 10: 128,574,449 T647A probably benign Het
Esrp2 T C 8: 106,134,276 T205A probably benign Het
Fbxw7 T C 3: 84,967,565 probably null Het
Fmn1 C T 2: 113,525,814 P965S unknown Het
Fndc7 C T 3: 108,870,663 V412M possibly damaging Het
G2e3 C A 12: 51,369,056 A525E probably damaging Het
Gcfc2 C T 6: 81,941,390 R354C probably damaging Het
Ggt1 T A 10: 75,585,674 N510K probably damaging Het
Gnas C T 2: 174,299,027 T389I unknown Het
Hapln3 C T 7: 79,117,373 R306H probably benign Het
Hydin T C 8: 110,593,812 L4496P possibly damaging Het
Iqgap2 T A 13: 95,731,444 I219L probably benign Het
Kcnj2 T C 11: 111,072,483 S234P probably benign Het
Lipf T A 19: 33,973,065 S286T probably damaging Het
Lrrc32 G T 7: 98,499,338 G442W probably damaging Het
Megf10 GGCAGCAACAGCACCAGCAGCAACAGCACCAGCAGCA GGCAGCAACAGCACCAGCAGCA 18: 57,293,999 probably benign Het
Mtmr4 T C 11: 87,597,724 V68A probably damaging Het
Mug2 T C 6: 122,078,795 S1146P possibly damaging Het
Naa35 T C 13: 59,598,105 I75T probably benign Het
Nepn T A 10: 52,401,178 F337I probably benign Het
Nf1 A G 11: 79,425,606 M496V probably benign Het
Nthl1 A T 17: 24,638,657 I277F possibly damaging Het
Olfr1208 T C 2: 88,897,778 probably benign Het
Olfr518 A C 7: 108,880,682 I308S probably damaging Het
Osr1 A T 12: 9,579,253 Y42F probably damaging Het
Rad54l2 G A 9: 106,717,223 R369W probably damaging Het
Ryr3 T A 2: 112,635,346 T4828S probably benign Het
Slc25a54 T A 3: 109,102,817 C211S probably damaging Het
Ube4b C T 4: 149,398,781 R10Q possibly damaging Het
Usp9y G A Y: 1,304,411 Q2440* probably null Het
Zfp26 G A 9: 20,441,334 T145I probably benign Het
Zic5 T C 14: 122,464,113 N402S unknown Het
Other mutations in Yars
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01681:Yars APN 4 129206142 missense probably damaging 1.00
IGL02039:Yars APN 4 129215259 missense probably damaging 1.00
IGL03324:Yars APN 4 129210535 missense probably benign 0.01
R0023:Yars UTSW 4 129197188 missense probably benign 0.08
R0023:Yars UTSW 4 129197188 missense probably benign 0.08
R0646:Yars UTSW 4 129213939 unclassified probably benign
R0746:Yars UTSW 4 129197286 missense probably damaging 1.00
R0894:Yars UTSW 4 129197155 missense probably damaging 0.97
R2115:Yars UTSW 4 129207923 intron probably null
R2134:Yars UTSW 4 129197199 nonsense probably null
R2189:Yars UTSW 4 129206189 missense probably damaging 1.00
R4190:Yars UTSW 4 129200027 nonsense probably null
R4863:Yars UTSW 4 129189882 unclassified probably benign
R4915:Yars UTSW 4 129210591 unclassified probably benign
R5450:Yars UTSW 4 129197246 missense possibly damaging 0.94
R5631:Yars UTSW 4 129209749 missense probably damaging 1.00
R5789:Yars UTSW 4 129196897 missense probably damaging 1.00
R6384:Yars UTSW 4 129196978 critical splice donor site probably null
R6837:Yars UTSW 4 129209751 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- GTGTGGCTGCTTATCTATTAGAGAAC -3'
(R):5'- TGGCTACCAAGACAGAGCTG -3'

Sequencing Primer
(F):5'- CTCAGCTGAGAGGCCATGTTTAAC -3'
(R):5'- AGCTGTATGTTCACACAGGC -3'
Posted On2019-11-12