Mutagenetix > Incidental Mutations

Incidental Mutation 'R7713:Ube4b'

594726

Institutional Source

Beutler Lab

Gene Symbol

Ube4b

Ensembl Gene

ENSMUSG00000028960

Gene Name

ubiquitination factor E4B

Synonyms

UFD2a, 4930551I19Rik, Ufd2p, 4933406G05Rik, UFD2, D4Bwg0973e

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7713 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

149328416-149426749 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 149398781 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glutamine at position 10 (R10Q)

Ref Sequence

ENSEMBL: ENSMUSP00000099501 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000103212] [ENSMUST00000172836] [ENSMUST00000174343]

PDB Structure

U-box domain of the E3 Ubiquitin Ligase E4B [SOLUTION NMR]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000103212
AA Change: R10Q

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000099501
Gene: ENSMUSG00000028960
AA Change: R10Q

Domain	Start	End	E-Value	Type
low complexity region	10	20	N/A	INTRINSIC
low complexity region	21	33	N/A	INTRINSIC
low complexity region	37	50	N/A	INTRINSIC
low complexity region	76	99	N/A	INTRINSIC
low complexity region	261	278	N/A	INTRINSIC
low complexity region	439	452	N/A	INTRINSIC
Pfam:Ufd2P_core	462	1083	1.3e-199	PFAM
Ubox	1102	1164	3.94e-25	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000172836
AA Change: R10Q

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000134452
Gene: ENSMUSG00000028960
AA Change: R10Q

Domain	Start	End	E-Value	Type
low complexity region	10	20	N/A	INTRINSIC
low complexity region	21	33	N/A	INTRINSIC
low complexity region	37	50	N/A	INTRINSIC
low complexity region	76	99	N/A	INTRINSIC
low complexity region	261	278	N/A	INTRINSIC
low complexity region	439	452	N/A	INTRINSIC
Pfam:Ufd2P_core	462	983	7.4e-143	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000174343
AA Change: R10Q

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000134556
Gene: ENSMUSG00000028960
AA Change: R10Q

Domain	Start	End	E-Value	Type
low complexity region	10	20	N/A	INTRINSIC
low complexity region	21	33	N/A	INTRINSIC
low complexity region	37	50	N/A	INTRINSIC
low complexity region	76	99	N/A	INTRINSIC
low complexity region	261	278	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes an additional conjugation factor, E4, which is involved in multiubiquitin chain assembly. This gene is also the strongest candidate in the neuroblastoma tumor suppressor genes. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a disruption in this gene die by midgestation and exhibit cardiac development defects such as hemorrhage and cardiomyocyte apoptosis. Heterozygous mice exhibit axonal dystrophy in the nucleus gracilis, degeneration of Purkinje cells and gait abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700113H08Rik	T	C	10: 87,230,311	S119P	possibly damaging	Het
Agtpbp1	T	A	13: 59,514,152	I282F	probably damaging	Het
Armh1	A	T	4: 117,214,228	M355K	possibly damaging	Het
BC067074	T	G	13: 113,346,541	V1559G		Het
Cep128	A	T	12: 91,019,322	D1013E	probably benign	Het
Clock	A	T	5: 76,245,420		probably null	Het
D630003M21Rik	G	A	2: 158,216,778	Q401*	probably null	Het
Dnah17	C	A	11: 118,025,171	V4302L	probably benign	Het
Drc3	A	G	11: 60,370,560	Y179C	probably benign	Het
Erbb3	T	C	10: 128,574,449	T647A	probably benign	Het
Esrp2	T	C	8: 106,134,276	T205A	probably benign	Het
Fbxw7	T	C	3: 84,967,565		probably null	Het
Fmn1	C	T	2: 113,525,814	P965S	unknown	Het
Fndc7	C	T	3: 108,870,663	V412M	possibly damaging	Het
G2e3	C	A	12: 51,369,056	A525E	probably damaging	Het
Gcfc2	C	T	6: 81,941,390	R354C	probably damaging	Het
Ggt1	T	A	10: 75,585,674	N510K	probably damaging	Het
Gnas	C	T	2: 174,299,027	T389I	unknown	Het
Hapln3	C	T	7: 79,117,373	R306H	probably benign	Het
Hydin	T	C	8: 110,593,812	L4496P	possibly damaging	Het
Iqgap2	T	A	13: 95,731,444	I219L	probably benign	Het
Kcnj2	T	C	11: 111,072,483	S234P	probably benign	Het
Lipf	T	A	19: 33,973,065	S286T	probably damaging	Het
Lrrc32	G	T	7: 98,499,338	G442W	probably damaging	Het
Megf10	GGCAGCAACAGCACCAGCAGCAACAGCACCAGCAGCA	GGCAGCAACAGCACCAGCAGCA	18: 57,293,999		probably benign	Het
Mtmr4	T	C	11: 87,597,724	V68A	probably damaging	Het
Mug2	T	C	6: 122,078,795	S1146P	possibly damaging	Het
Naa35	T	C	13: 59,598,105	I75T	probably benign	Het
Nepn	T	A	10: 52,401,178	F337I	probably benign	Het
Nf1	A	G	11: 79,425,606	M496V	probably benign	Het
Nthl1	A	T	17: 24,638,657	I277F	possibly damaging	Het
Olfr1208	T	C	2: 88,897,778		probably benign	Het
Olfr518	A	C	7: 108,880,682	I308S	probably damaging	Het
Osr1	A	T	12: 9,579,253	Y42F	probably damaging	Het
Rad54l2	G	A	9: 106,717,223	R369W	probably damaging	Het
Ryr3	T	A	2: 112,635,346	T4828S	probably benign	Het
Slc25a54	T	A	3: 109,102,817	C211S	probably damaging	Het
Usp9y	G	A	Y: 1,304,411	Q2440*	probably null	Het
Yars	G	T	4: 129,210,498	V312L	probably benign	Het
Zfp26	G	A	9: 20,441,334	T145I	probably benign	Het
Zic5	T	C	14: 122,464,113	N402S	unknown	Het

Other mutations in Ube4b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00672:Ube4b	APN	4	149381366	missense	probably benign	0.29
IGL00820:Ube4b	APN	4	149352921	splice site	probably benign
IGL01093:Ube4b	APN	4	149330269	missense	probably benign	0.01
IGL01154:Ube4b	APN	4	149365470	missense	probably benign	0.28
IGL01612:Ube4b	APN	4	149383818	missense	probably damaging	0.98
IGL01800:Ube4b	APN	4	149331494	missense	probably damaging	1.00
IGL02149:Ube4b	APN	4	149398684	missense	possibly damaging	0.88
IGL02472:Ube4b	APN	4	149387079	critical splice donor site	probably null
IGL02839:Ube4b	APN	4	149368399	missense	probably damaging	0.98
IGL03027:Ube4b	APN	4	149381277	missense	probably damaging	1.00
R0143:Ube4b	UTSW	4	149355457	missense	possibly damaging	0.61
R0164:Ube4b	UTSW	4	149360324	missense	probably damaging	0.98
R0164:Ube4b	UTSW	4	149360324	missense	probably damaging	0.98
R0206:Ube4b	UTSW	4	149398637	missense	probably benign	0.38
R0591:Ube4b	UTSW	4	149357577	intron	probably benign
R1366:Ube4b	UTSW	4	149335149	missense	probably damaging	0.98
R1452:Ube4b	UTSW	4	149371169	missense	probably damaging	1.00
R1513:Ube4b	UTSW	4	149351578	missense	probably benign	0.17
R1668:Ube4b	UTSW	4	149361294	missense	probably benign	0.02
R1874:Ube4b	UTSW	4	149347971	missense	probably damaging	1.00
R2002:Ube4b	UTSW	4	149383797	missense	probably benign	0.16
R2050:Ube4b	UTSW	4	149344612	missense	probably damaging	1.00
R2109:Ube4b	UTSW	4	149372841	missense	probably benign	0.00
R2281:Ube4b	UTSW	4	149344572	missense	probably damaging	1.00
R3547:Ube4b	UTSW	4	149335116	missense	probably damaging	1.00
R3881:Ube4b	UTSW	4	149365404	splice site	probably null
R4378:Ube4b	UTSW	4	149383798	missense	probably damaging	1.00
R4563:Ube4b	UTSW	4	149359165	intron	probably benign
R4674:Ube4b	UTSW	4	149331370	missense	possibly damaging	0.86
R4716:Ube4b	UTSW	4	149344612	missense	probably damaging	1.00
R5026:Ube4b	UTSW	4	149360565	missense	probably damaging	1.00
R5125:Ube4b	UTSW	4	149342992	missense	probably damaging	1.00
R5178:Ube4b	UTSW	4	149342992	missense	probably damaging	1.00
R5182:Ube4b	UTSW	4	149381242	missense	probably null	0.08
R5229:Ube4b	UTSW	4	149387178	missense	probably damaging	1.00
R5303:Ube4b	UTSW	4	149383803	missense	probably damaging	0.98
R5346:Ube4b	UTSW	4	149337424	missense	possibly damaging	0.91
R5780:Ube4b	UTSW	4	149331364	missense	probably benign	0.00
R5813:Ube4b	UTSW	4	149337468	missense	probably damaging	1.00
R5842:Ube4b	UTSW	4	149331430	missense	probably benign	0.01
R5994:Ube4b	UTSW	4	149372932	missense	probably damaging	0.97
R6020:Ube4b	UTSW	4	149368311	missense	probably benign	0.17
R6125:Ube4b	UTSW	4	149398746	missense	probably benign	0.13
R6272:Ube4b	UTSW	4	149387133	missense	probably damaging	1.00
R6333:Ube4b	UTSW	4	149348037	missense	probably damaging	1.00
R6426:Ube4b	UTSW	4	149425996	unclassified	probably benign
R7203:Ube4b	UTSW	4	149398610	missense	probably benign	0.30
R7341:Ube4b	UTSW	4	149343001	missense	probably damaging	1.00
R7672:Ube4b	UTSW	4	149387204	missense	probably benign	0.10
R8175:Ube4b	UTSW	4	149351516	missense	probably benign	0.13
Z1088:Ube4b	UTSW	4	149335125	missense	possibly damaging	0.83

Predicted Primers

PCR Primer
(F):5'- AAAGTACAGCTTCCAGGTTGG -3'
(R):5'- GGAACATTTGCTTTGCCTTGTTAC -3'

Sequencing Primer
(F):5'- TCACCTGCTGCACCTATGGG -3'
(R):5'- ACATATGGTTGTGAGCCACC -3'

Posted On

2019-11-12