Incidental Mutation 'R7713:Olfr518'
ID594732
Institutional Source Beutler Lab
Gene Symbol Olfr518
Ensembl Gene ENSMUSG00000046431
Gene Nameolfactory receptor 518
SynonymsMOR268-5, GA_x6K02T2PBJ9-11211854-11210853
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.147) question?
Stock #R7713 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location108880188-108885006 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 108880682 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Serine at position 308 (I308S)
Ref Sequence ENSEMBL: ENSMUSP00000151883 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059617] [ENSMUST00000217803]
Predicted Effect probably damaging
Transcript: ENSMUST00000059617
AA Change: I308S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000050503
Gene: ENSMUSG00000046431
AA Change: I308S

DomainStartEndE-ValueType
low complexity region 11 22 N/A INTRINSIC
Pfam:7tm_4 50 327 7.1e-60 PFAM
Pfam:7tm_1 60 318 1.4e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000217803
AA Change: I308S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik T C 10: 87,230,311 S119P possibly damaging Het
Agtpbp1 T A 13: 59,514,152 I282F probably damaging Het
Armh1 A T 4: 117,214,228 M355K possibly damaging Het
BC067074 T G 13: 113,346,541 V1559G Het
Cep128 A T 12: 91,019,322 D1013E probably benign Het
Clock A T 5: 76,245,420 probably null Het
D630003M21Rik G A 2: 158,216,778 Q401* probably null Het
Dnah17 C A 11: 118,025,171 V4302L probably benign Het
Drc3 A G 11: 60,370,560 Y179C probably benign Het
Erbb3 T C 10: 128,574,449 T647A probably benign Het
Esrp2 T C 8: 106,134,276 T205A probably benign Het
Fbxw7 T C 3: 84,967,565 probably null Het
Fmn1 C T 2: 113,525,814 P965S unknown Het
Fndc7 C T 3: 108,870,663 V412M possibly damaging Het
G2e3 C A 12: 51,369,056 A525E probably damaging Het
Gcfc2 C T 6: 81,941,390 R354C probably damaging Het
Ggt1 T A 10: 75,585,674 N510K probably damaging Het
Gnas C T 2: 174,299,027 T389I unknown Het
Hapln3 C T 7: 79,117,373 R306H probably benign Het
Hydin T C 8: 110,593,812 L4496P possibly damaging Het
Iqgap2 T A 13: 95,731,444 I219L probably benign Het
Kcnj2 T C 11: 111,072,483 S234P probably benign Het
Lipf T A 19: 33,973,065 S286T probably damaging Het
Lrrc32 G T 7: 98,499,338 G442W probably damaging Het
Megf10 GGCAGCAACAGCACCAGCAGCAACAGCACCAGCAGCA GGCAGCAACAGCACCAGCAGCA 18: 57,293,999 probably benign Het
Mtmr4 T C 11: 87,597,724 V68A probably damaging Het
Mug2 T C 6: 122,078,795 S1146P possibly damaging Het
Naa35 T C 13: 59,598,105 I75T probably benign Het
Nepn T A 10: 52,401,178 F337I probably benign Het
Nf1 A G 11: 79,425,606 M496V probably benign Het
Nthl1 A T 17: 24,638,657 I277F possibly damaging Het
Olfr1208 T C 2: 88,897,778 probably benign Het
Osr1 A T 12: 9,579,253 Y42F probably damaging Het
Rad54l2 G A 9: 106,717,223 R369W probably damaging Het
Ryr3 T A 2: 112,635,346 T4828S probably benign Het
Slc25a54 T A 3: 109,102,817 C211S probably damaging Het
Ube4b C T 4: 149,398,781 R10Q possibly damaging Het
Usp9y G A Y: 1,304,411 Q2440* probably null Het
Yars G T 4: 129,210,498 V312L probably benign Het
Zfp26 G A 9: 20,441,334 T145I probably benign Het
Zic5 T C 14: 122,464,113 N402S unknown Het
Other mutations in Olfr518
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02713:Olfr518 APN 7 108880853 missense probably damaging 0.99
IGL02995:Olfr518 APN 7 108880991 missense probably damaging 1.00
IGL03162:Olfr518 APN 7 108881604 start codon destroyed probably null
IGL03389:Olfr518 APN 7 108880775 missense probably damaging 0.99
R0731:Olfr518 UTSW 7 108881533 missense probably damaging 1.00
R1669:Olfr518 UTSW 7 108880713 missense probably benign 0.00
R2235:Olfr518 UTSW 7 108880965 missense probably benign 0.09
R4740:Olfr518 UTSW 7 108881482 missense probably benign 0.05
R4902:Olfr518 UTSW 7 108881417 missense probably benign 0.00
R5343:Olfr518 UTSW 7 108880998 missense possibly damaging 0.87
R6744:Olfr518 UTSW 7 108880830 missense probably damaging 0.99
R7157:Olfr518 UTSW 7 108881268 missense probably benign 0.03
R7326:Olfr518 UTSW 7 108880816 missense probably damaging 1.00
R7819:Olfr518 UTSW 7 108881403 missense probably damaging 0.99
R7939:Olfr518 UTSW 7 108881274 missense probably benign 0.05
R8057:Olfr518 UTSW 7 108881364 missense probably damaging 1.00
R8096:Olfr518 UTSW 7 108881041 nonsense probably null
X0066:Olfr518 UTSW 7 108881472 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAGGGGAATAATGTAATATGCTTCC -3'
(R):5'- AGGCACCATTTTGATTGTCATG -3'

Sequencing Primer
(F):5'- ATGCTTCCAAGTATGAAGATATCAAG -3'
(R):5'- GATGCCATCCACTACAGGGAG -3'
Posted On2019-11-12