Incidental Mutation 'R7713:Esrp2'
ID594733
Institutional Source Beutler Lab
Gene Symbol Esrp2
Ensembl Gene ENSMUSG00000084128
Gene Nameepithelial splicing regulatory protein 2
Synonyms9530027K23Rik, Rbm35b
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7713 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location106130319-106136974 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 106134276 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 205 (T205A)
Ref Sequence ENSEMBL: ENSMUSP00000111639 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109308] [ENSMUST00000115979] [ENSMUST00000146940]
Predicted Effect probably benign
Transcript: ENSMUST00000109308
SMART Domains Protein: ENSMUSP00000104931
Gene: ENSMUSG00000031902

DomainStartEndE-ValueType
low complexity region 153 182 N/A INTRINSIC
low complexity region 205 225 N/A INTRINSIC
low complexity region 257 271 N/A INTRINSIC
low complexity region 286 305 N/A INTRINSIC
Pfam:RHD_DNA_bind 434 593 4.9e-25 PFAM
IPT 600 699 1.19e-20 SMART
low complexity region 713 722 N/A INTRINSIC
low complexity region 917 938 N/A INTRINSIC
low complexity region 954 967 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115979
AA Change: T205A

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000111639
Gene: ENSMUSG00000084128
AA Change: T205A

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
RRM 248 320 2.58e-1 SMART
RRM 349 424 2.67e-2 SMART
low complexity region 439 459 N/A INTRINSIC
RRM 466 541 4.17e-3 SMART
low complexity region 549 575 N/A INTRINSIC
low complexity region 593 614 N/A INTRINSIC
low complexity region 644 660 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146940
AA Change: T205A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000123114
Gene: ENSMUSG00000084128
AA Change: T205A

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
RRM 247 319 2.58e-1 SMART
RRM 348 423 2.67e-2 SMART
low complexity region 438 458 N/A INTRINSIC
RRM 465 540 4.17e-3 SMART
low complexity region 548 574 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ESPR2 is an epithelial cell-type-specific splicing regulator (Warzecha et al., 2009 [PubMed 19285943]).[supplied by OMIM, Aug 2009]
PHENOTYPE: Homozygous null mice exhibit defects in hepatic maturation, and decreased serum albumin levels and total serum protein levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik T C 10: 87,230,311 S119P possibly damaging Het
Agtpbp1 T A 13: 59,514,152 I282F probably damaging Het
Armh1 A T 4: 117,214,228 M355K possibly damaging Het
BC067074 T G 13: 113,346,541 V1559G Het
Cep128 A T 12: 91,019,322 D1013E probably benign Het
Clock A T 5: 76,245,420 probably null Het
D630003M21Rik G A 2: 158,216,778 Q401* probably null Het
Dnah17 C A 11: 118,025,171 V4302L probably benign Het
Drc3 A G 11: 60,370,560 Y179C probably benign Het
Erbb3 T C 10: 128,574,449 T647A probably benign Het
Fbxw7 T C 3: 84,967,565 probably null Het
Fmn1 C T 2: 113,525,814 P965S unknown Het
Fndc7 C T 3: 108,870,663 V412M possibly damaging Het
G2e3 C A 12: 51,369,056 A525E probably damaging Het
Gcfc2 C T 6: 81,941,390 R354C probably damaging Het
Ggt1 T A 10: 75,585,674 N510K probably damaging Het
Gnas C T 2: 174,299,027 T389I unknown Het
Hapln3 C T 7: 79,117,373 R306H probably benign Het
Hydin T C 8: 110,593,812 L4496P possibly damaging Het
Iqgap2 T A 13: 95,731,444 I219L probably benign Het
Kcnj2 T C 11: 111,072,483 S234P probably benign Het
Lipf T A 19: 33,973,065 S286T probably damaging Het
Lrrc32 G T 7: 98,499,338 G442W probably damaging Het
Megf10 GGCAGCAACAGCACCAGCAGCAACAGCACCAGCAGCA GGCAGCAACAGCACCAGCAGCA 18: 57,293,999 probably benign Het
Mtmr4 T C 11: 87,597,724 V68A probably damaging Het
Mug2 T C 6: 122,078,795 S1146P possibly damaging Het
Naa35 T C 13: 59,598,105 I75T probably benign Het
Nepn T A 10: 52,401,178 F337I probably benign Het
Nf1 A G 11: 79,425,606 M496V probably benign Het
Nthl1 A T 17: 24,638,657 I277F possibly damaging Het
Olfr1208 T C 2: 88,897,778 probably benign Het
Olfr518 A C 7: 108,880,682 I308S probably damaging Het
Osr1 A T 12: 9,579,253 Y42F probably damaging Het
Rad54l2 G A 9: 106,717,223 R369W probably damaging Het
Ryr3 T A 2: 112,635,346 T4828S probably benign Het
Slc25a54 T A 3: 109,102,817 C211S probably damaging Het
Ube4b C T 4: 149,398,781 R10Q possibly damaging Het
Usp9y G A Y: 1,304,411 Q2440* probably null Het
Yars G T 4: 129,210,498 V312L probably benign Het
Zfp26 G A 9: 20,441,334 T145I probably benign Het
Zic5 T C 14: 122,464,113 N402S unknown Het
Other mutations in Esrp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01527:Esrp2 APN 8 106132233 missense probably benign 0.00
R0419:Esrp2 UTSW 8 106134675 missense probably damaging 1.00
R1468:Esrp2 UTSW 8 106133821 missense probably damaging 1.00
R1468:Esrp2 UTSW 8 106133821 missense probably damaging 1.00
R1528:Esrp2 UTSW 8 106136752 missense unknown
R1598:Esrp2 UTSW 8 106133273 missense probably damaging 0.97
R1817:Esrp2 UTSW 8 106134618 missense probably damaging 1.00
R1885:Esrp2 UTSW 8 106131821 missense possibly damaging 0.80
R1886:Esrp2 UTSW 8 106133857 missense probably damaging 1.00
R2323:Esrp2 UTSW 8 106134302 missense probably benign 0.27
R3761:Esrp2 UTSW 8 106133622 missense probably damaging 1.00
R4598:Esrp2 UTSW 8 106132711 missense probably damaging 1.00
R4792:Esrp2 UTSW 8 106132509 missense probably damaging 1.00
R5091:Esrp2 UTSW 8 106132429 missense probably damaging 1.00
R5114:Esrp2 UTSW 8 106132188 missense probably benign 0.42
R5162:Esrp2 UTSW 8 106133298 missense probably damaging 1.00
R5678:Esrp2 UTSW 8 106132118 missense probably damaging 0.97
R5947:Esrp2 UTSW 8 106132933 unclassified probably benign
R7760:Esrp2 UTSW 8 106133470 missense probably benign 0.03
R8348:Esrp2 UTSW 8 106132221 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCTTCGAGAACAACTGAC -3'
(R):5'- AGGTACATGTATGAACTGGGCC -3'

Sequencing Primer
(F):5'- TGGAGGAAGTCTCTCCACCAAG -3'
(R):5'- TGTATGAACTGGGCCACAAC -3'
Posted On2019-11-12