Incidental Mutation 'R7713:1700113H08Rik'
ID594739
Institutional Source Beutler Lab
Gene Symbol 1700113H08Rik
Ensembl Gene ENSMUSG00000047129
Gene NameRIKEN cDNA 1700113H08 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R7713 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location87058045-87230589 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87230311 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 119 (S119P)
Ref Sequence ENSEMBL: ENSMUSP00000141184 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169849] [ENSMUST00000189456] [ENSMUST00000189775]
Predicted Effect probably damaging
Transcript: ENSMUST00000169849
AA Change: S285P

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000130852
Gene: ENSMUSG00000047129
AA Change: S285P

DomainStartEndE-ValueType
Pfam:DUF4607 71 325 2.1e-113 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000189456
AA Change: S165P

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000140447
Gene: ENSMUSG00000047129
AA Change: S165P

DomainStartEndE-ValueType
Pfam:DUF4607 45 206 6.2e-38 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000189775
AA Change: S119P

PolyPhen 2 Score 0.804 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000141184
Gene: ENSMUSG00000047129
AA Change: S119P

DomainStartEndE-ValueType
Pfam:DUF4607 6 160 6.8e-43 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtpbp1 T A 13: 59,514,152 I282F probably damaging Het
Armh1 A T 4: 117,214,228 M355K possibly damaging Het
BC067074 T G 13: 113,346,541 V1559G Het
Cep128 A T 12: 91,019,322 D1013E probably benign Het
Clock A T 5: 76,245,420 probably null Het
D630003M21Rik G A 2: 158,216,778 Q401* probably null Het
Dnah17 C A 11: 118,025,171 V4302L probably benign Het
Drc3 A G 11: 60,370,560 Y179C probably benign Het
Erbb3 T C 10: 128,574,449 T647A probably benign Het
Esrp2 T C 8: 106,134,276 T205A probably benign Het
Fbxw7 T C 3: 84,967,565 probably null Het
Fmn1 C T 2: 113,525,814 P965S unknown Het
Fndc7 C T 3: 108,870,663 V412M possibly damaging Het
G2e3 C A 12: 51,369,056 A525E probably damaging Het
Gcfc2 C T 6: 81,941,390 R354C probably damaging Het
Ggt1 T A 10: 75,585,674 N510K probably damaging Het
Gnas C T 2: 174,299,027 T389I unknown Het
Hapln3 C T 7: 79,117,373 R306H probably benign Het
Hydin T C 8: 110,593,812 L4496P possibly damaging Het
Iqgap2 T A 13: 95,731,444 I219L probably benign Het
Kcnj2 T C 11: 111,072,483 S234P probably benign Het
Lipf T A 19: 33,973,065 S286T probably damaging Het
Lrrc32 G T 7: 98,499,338 G442W probably damaging Het
Megf10 GGCAGCAACAGCACCAGCAGCAACAGCACCAGCAGCA GGCAGCAACAGCACCAGCAGCA 18: 57,293,999 probably benign Het
Mtmr4 T C 11: 87,597,724 V68A probably damaging Het
Mug2 T C 6: 122,078,795 S1146P possibly damaging Het
Naa35 T C 13: 59,598,105 I75T probably benign Het
Nepn T A 10: 52,401,178 F337I probably benign Het
Nf1 A G 11: 79,425,606 M496V probably benign Het
Nthl1 A T 17: 24,638,657 I277F possibly damaging Het
Olfr1208 T C 2: 88,897,778 probably benign Het
Olfr518 A C 7: 108,880,682 I308S probably damaging Het
Osr1 A T 12: 9,579,253 Y42F probably damaging Het
Rad54l2 G A 9: 106,717,223 R369W probably damaging Het
Ryr3 T A 2: 112,635,346 T4828S probably benign Het
Slc25a54 T A 3: 109,102,817 C211S probably damaging Het
Ube4b C T 4: 149,398,781 R10Q possibly damaging Het
Usp9y G A Y: 1,304,411 Q2440* probably null Het
Yars G T 4: 129,210,498 V312L probably benign Het
Zfp26 G A 9: 20,441,334 T145I probably benign Het
Zic5 T C 14: 122,464,113 N402S unknown Het
Other mutations in 1700113H08Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01688:1700113H08Rik APN 10 87165123 missense probably damaging 1.00
IGL01764:1700113H08Rik APN 10 87074046 start codon destroyed probably benign 0.02
IGL02173:1700113H08Rik APN 10 87225892 missense possibly damaging 0.63
IGL02756:1700113H08Rik APN 10 87165108 missense probably damaging 0.99
IGL03202:1700113H08Rik APN 10 87074047 start codon destroyed probably null 0.35
IGL03393:1700113H08Rik APN 10 87074038 utr 5 prime probably benign
R0255:1700113H08Rik UTSW 10 87226045 missense probably damaging 1.00
R0409:1700113H08Rik UTSW 10 87225954 missense probably damaging 0.98
R0744:1700113H08Rik UTSW 10 87165069 missense probably damaging 1.00
R0833:1700113H08Rik UTSW 10 87165069 missense probably damaging 1.00
R1163:1700113H08Rik UTSW 10 87121422 missense probably damaging 0.99
R2128:1700113H08Rik UTSW 10 87230204 missense possibly damaging 0.94
R2129:1700113H08Rik UTSW 10 87230204 missense possibly damaging 0.94
R4108:1700113H08Rik UTSW 10 87225934 missense probably damaging 1.00
R5541:1700113H08Rik UTSW 10 87225946 missense probably benign 0.00
R6345:1700113H08Rik UTSW 10 87226051 missense probably benign 0.43
R6372:1700113H08Rik UTSW 10 87230226 missense possibly damaging 0.92
R6710:1700113H08Rik UTSW 10 87226061 missense probably benign 0.00
R6971:1700113H08Rik UTSW 10 87165041 missense possibly damaging 0.91
R7055:1700113H08Rik UTSW 10 87226221 missense probably damaging 0.99
R7808:1700113H08Rik UTSW 10 87121435 missense probably benign 0.33
R7838:1700113H08Rik UTSW 10 87206199 splice site probably null
R8293:1700113H08Rik UTSW 10 87226002 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- ACAGATTCCCTAACCGTGTGC -3'
(R):5'- GCGTAACAATGGTTCTGTGG -3'

Sequencing Primer
(F):5'- TGCGGAAGTGCATTAGGAAG -3'
(R):5'- TCTGTGGAAACCAATACATCTGAGGC -3'
Posted On2019-11-12