Incidental Mutation 'R7713:Drc3'
ID594741
Institutional Source Beutler Lab
Gene Symbol Drc3
Ensembl Gene ENSMUSG00000056598
Gene Namedynein regulatory complex subunit 3
Synonyms4930449E07Rik, Lrrc48, m6Bei
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R7713 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location60353329-60394341 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 60370560 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 179 (Y179C)
Ref Sequence ENSEMBL: ENSMUSP00000065525 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070805] [ENSMUST00000094140] [ENSMUST00000108722] [ENSMUST00000108723]
Predicted Effect probably benign
Transcript: ENSMUST00000070805
AA Change: Y179C

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000065525
Gene: ENSMUSG00000056598
AA Change: Y179C

DomainStartEndE-ValueType
low complexity region 66 75 N/A INTRINSIC
LRR 86 106 9.24e1 SMART
LRR 108 129 1.71e1 SMART
LRR 130 153 1.49e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000094140
AA Change: Y179C

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000091691
Gene: ENSMUSG00000056598
AA Change: Y179C

DomainStartEndE-ValueType
low complexity region 66 75 N/A INTRINSIC
LRR 86 106 9.24e1 SMART
LRR 108 129 1.71e1 SMART
LRR 130 153 1.49e1 SMART
low complexity region 216 235 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108722
AA Change: Y179C

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104362
Gene: ENSMUSG00000056598
AA Change: Y179C

DomainStartEndE-ValueType
low complexity region 66 75 N/A INTRINSIC
LRR 86 106 9.24e1 SMART
LRR 108 129 1.71e1 SMART
LRR 130 153 1.49e1 SMART
low complexity region 216 235 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108723
AA Change: Y179C

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104363
Gene: ENSMUSG00000056598
AA Change: Y179C

DomainStartEndE-ValueType
low complexity region 66 75 N/A INTRINSIC
LRR 86 106 9.24e1 SMART
LRR 108 129 1.71e1 SMART
LRR 130 153 1.49e1 SMART
low complexity region 216 235 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik T C 10: 87,230,311 S119P possibly damaging Het
Agtpbp1 T A 13: 59,514,152 I282F probably damaging Het
Armh1 A T 4: 117,214,228 M355K possibly damaging Het
BC067074 T G 13: 113,346,541 V1559G Het
Cep128 A T 12: 91,019,322 D1013E probably benign Het
Clock A T 5: 76,245,420 probably null Het
D630003M21Rik G A 2: 158,216,778 Q401* probably null Het
Dnah17 C A 11: 118,025,171 V4302L probably benign Het
Erbb3 T C 10: 128,574,449 T647A probably benign Het
Esrp2 T C 8: 106,134,276 T205A probably benign Het
Fbxw7 T C 3: 84,967,565 probably null Het
Fmn1 C T 2: 113,525,814 P965S unknown Het
Fndc7 C T 3: 108,870,663 V412M possibly damaging Het
G2e3 C A 12: 51,369,056 A525E probably damaging Het
Gcfc2 C T 6: 81,941,390 R354C probably damaging Het
Ggt1 T A 10: 75,585,674 N510K probably damaging Het
Gnas C T 2: 174,299,027 T389I unknown Het
Hapln3 C T 7: 79,117,373 R306H probably benign Het
Hydin T C 8: 110,593,812 L4496P possibly damaging Het
Iqgap2 T A 13: 95,731,444 I219L probably benign Het
Kcnj2 T C 11: 111,072,483 S234P probably benign Het
Lipf T A 19: 33,973,065 S286T probably damaging Het
Lrrc32 G T 7: 98,499,338 G442W probably damaging Het
Megf10 GGCAGCAACAGCACCAGCAGCAACAGCACCAGCAGCA GGCAGCAACAGCACCAGCAGCA 18: 57,293,999 probably benign Het
Mtmr4 T C 11: 87,597,724 V68A probably damaging Het
Mug2 T C 6: 122,078,795 S1146P possibly damaging Het
Naa35 T C 13: 59,598,105 I75T probably benign Het
Nepn T A 10: 52,401,178 F337I probably benign Het
Nf1 A G 11: 79,425,606 M496V probably benign Het
Nthl1 A T 17: 24,638,657 I277F possibly damaging Het
Olfr1208 T C 2: 88,897,778 probably benign Het
Olfr518 A C 7: 108,880,682 I308S probably damaging Het
Osr1 A T 12: 9,579,253 Y42F probably damaging Het
Rad54l2 G A 9: 106,717,223 R369W probably damaging Het
Ryr3 T A 2: 112,635,346 T4828S probably benign Het
Slc25a54 T A 3: 109,102,817 C211S probably damaging Het
Ube4b C T 4: 149,398,781 R10Q possibly damaging Het
Usp9y G A Y: 1,304,411 Q2440* probably null Het
Yars G T 4: 129,210,498 V312L probably benign Het
Zfp26 G A 9: 20,441,334 T145I probably benign Het
Zic5 T C 14: 122,464,113 N402S unknown Het
Other mutations in Drc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01319:Drc3 APN 11 60364962 missense probably null 0.70
IGL01457:Drc3 APN 11 60358649 utr 5 prime probably benign
IGL02329:Drc3 APN 11 60370578 missense probably damaging 1.00
IGL02576:Drc3 APN 11 60370551 missense probably benign 0.01
IGL02610:Drc3 APN 11 60370593 missense probably benign 0.40
IGL02817:Drc3 APN 11 60384236 missense probably benign 0.16
IGL03380:Drc3 APN 11 60377905 missense probably benign 0.01
R0020:Drc3 UTSW 11 60370545 missense probably damaging 1.00
R1221:Drc3 UTSW 11 60384226 missense probably benign
R1394:Drc3 UTSW 11 60393719 missense possibly damaging 0.94
R1483:Drc3 UTSW 11 60388889 missense probably benign 0.00
R2093:Drc3 UTSW 11 60370484 missense probably damaging 1.00
R2151:Drc3 UTSW 11 60375157 missense probably benign 0.15
R4631:Drc3 UTSW 11 60364908 missense probably benign 0.02
R4796:Drc3 UTSW 11 60363528 missense probably damaging 1.00
R4841:Drc3 UTSW 11 60370535 missense probably benign 0.00
R4842:Drc3 UTSW 11 60370535 missense probably benign 0.00
R5739:Drc3 UTSW 11 60375130 missense possibly damaging 0.89
R5766:Drc3 UTSW 11 60393821 missense probably benign 0.18
R6143:Drc3 UTSW 11 60370580 missense possibly damaging 0.82
R6298:Drc3 UTSW 11 60393770 missense possibly damaging 0.74
R6558:Drc3 UTSW 11 60364892 missense probably damaging 1.00
R6611:Drc3 UTSW 11 60364947 missense probably damaging 0.99
R6938:Drc3 UTSW 11 60394123 critical splice acceptor site probably null
R7013:Drc3 UTSW 11 60387303 missense probably benign 0.00
R7108:Drc3 UTSW 11 60370554 missense probably benign 0.13
R7640:Drc3 UTSW 11 60388904 missense probably benign
Predicted Primers PCR Primer
(F):5'- CACCTGACTATATGCAGGGTG -3'
(R):5'- GAGACTATTGCTGGAGTGGC -3'

Sequencing Primer
(F):5'- CAGGTTGTGGACTCAGGAAG -3'
(R):5'- CTGGAGTGGCTGTGCACAG -3'
Posted On2019-11-12