Incidental Mutation 'R7713:Kcnj2'
ID594744
Institutional Source Beutler Lab
Gene Symbol Kcnj2
Ensembl Gene ENSMUSG00000041695
Gene Namepotassium inwardly-rectifying channel, subfamily J, member 2
SynonymsIRK1, Kcnf1, Kir2.1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7713 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location111066164-111076821 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 111072483 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 234 (S234P)
Ref Sequence ENSEMBL: ENSMUSP00000037192 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042970]
PDB Structure
Crystal Structure of Cytoplasmic Domains of IRK1 (Kir2.1) channel [X-RAY DIFFRACTION]
Cytoplasmic Domain Structure of Kir2.1 containing Andersen's Mutation R218Q and Rescue Mutation T309K [X-RAY DIFFRACTION]
Single particle analysis of Kir2.1NC_4 in negative stain [SOLUTION SCATTERING, ELECTRON MICROSCOPY]
Predicted Effect probably benign
Transcript: ENSMUST00000042970
AA Change: S234P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000037192
Gene: ENSMUSG00000041695
AA Change: S234P

DomainStartEndE-ValueType
Pfam:IRK_N 1 47 2.9e-29 PFAM
Pfam:IRK 48 373 7.3e-158 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Potassium channels are present in most mammalian cells, where they participate in a wide range of physiologic responses. The protein encoded by this gene is an integral membrane protein and inward-rectifier type potassium channel. The encoded protein, which has a greater tendency to allow potassium to flow into a cell rather than out of a cell, probably participates in establishing action potential waveform and excitability of neuronal and muscle tissues. Mutations in this gene have been associated with Andersen syndrome, which is characterized by periodic paralysis, cardiac arrhythmias, and dysmorphic features. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation die within 8-12 hours after birth, displaying cyanosis and respiratory distress, as well as complete cleft of the secondary palate, and loss of K+-mediated vasodilatation in cerebral arteries. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik T C 10: 87,230,311 S119P possibly damaging Het
Agtpbp1 T A 13: 59,514,152 I282F probably damaging Het
Armh1 A T 4: 117,214,228 M355K possibly damaging Het
BC067074 T G 13: 113,346,541 V1559G Het
Cep128 A T 12: 91,019,322 D1013E probably benign Het
Clock A T 5: 76,245,420 probably null Het
D630003M21Rik G A 2: 158,216,778 Q401* probably null Het
Dnah17 C A 11: 118,025,171 V4302L probably benign Het
Drc3 A G 11: 60,370,560 Y179C probably benign Het
Erbb3 T C 10: 128,574,449 T647A probably benign Het
Esrp2 T C 8: 106,134,276 T205A probably benign Het
Fbxw7 T C 3: 84,967,565 probably null Het
Fmn1 C T 2: 113,525,814 P965S unknown Het
Fndc7 C T 3: 108,870,663 V412M possibly damaging Het
G2e3 C A 12: 51,369,056 A525E probably damaging Het
Gcfc2 C T 6: 81,941,390 R354C probably damaging Het
Ggt1 T A 10: 75,585,674 N510K probably damaging Het
Gnas C T 2: 174,299,027 T389I unknown Het
Hapln3 C T 7: 79,117,373 R306H probably benign Het
Hydin T C 8: 110,593,812 L4496P possibly damaging Het
Iqgap2 T A 13: 95,731,444 I219L probably benign Het
Lipf T A 19: 33,973,065 S286T probably damaging Het
Lrrc32 G T 7: 98,499,338 G442W probably damaging Het
Megf10 GGCAGCAACAGCACCAGCAGCAACAGCACCAGCAGCA GGCAGCAACAGCACCAGCAGCA 18: 57,293,999 probably benign Het
Mtmr4 T C 11: 87,597,724 V68A probably damaging Het
Mug2 T C 6: 122,078,795 S1146P possibly damaging Het
Naa35 T C 13: 59,598,105 I75T probably benign Het
Nepn T A 10: 52,401,178 F337I probably benign Het
Nf1 A G 11: 79,425,606 M496V probably benign Het
Nthl1 A T 17: 24,638,657 I277F possibly damaging Het
Olfr1208 T C 2: 88,897,778 probably benign Het
Olfr518 A C 7: 108,880,682 I308S probably damaging Het
Osr1 A T 12: 9,579,253 Y42F probably damaging Het
Rad54l2 G A 9: 106,717,223 R369W probably damaging Het
Ryr3 T A 2: 112,635,346 T4828S probably benign Het
Slc25a54 T A 3: 109,102,817 C211S probably damaging Het
Ube4b C T 4: 149,398,781 R10Q possibly damaging Het
Usp9y G A Y: 1,304,411 Q2440* probably null Het
Yars G T 4: 129,210,498 V312L probably benign Het
Zfp26 G A 9: 20,441,334 T145I probably benign Het
Zic5 T C 14: 122,464,113 N402S unknown Het
Other mutations in Kcnj2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00566:Kcnj2 APN 11 111071827 missense probably damaging 1.00
IGL02448:Kcnj2 APN 11 111072282 missense probably benign 0.00
R0090:Kcnj2 UTSW 11 111073027 missense probably benign 0.02
R1162:Kcnj2 UTSW 11 111072967 missense probably benign
R1990:Kcnj2 UTSW 11 111072883 missense probably benign 0.00
R3948:Kcnj2 UTSW 11 111072655 missense possibly damaging 0.73
R4417:Kcnj2 UTSW 11 111072189 missense probably damaging 1.00
R4605:Kcnj2 UTSW 11 111072850 missense probably damaging 1.00
R5191:Kcnj2 UTSW 11 111072471 nonsense probably null
R5439:Kcnj2 UTSW 11 111072231 missense probably damaging 1.00
R5530:Kcnj2 UTSW 11 111072091 missense probably damaging 1.00
R6167:Kcnj2 UTSW 11 111072489 missense probably benign
R7126:Kcnj2 UTSW 11 111072822 missense probably damaging 1.00
R8007:Kcnj2 UTSW 11 111073058 missense probably benign 0.24
X0052:Kcnj2 UTSW 11 111071856 missense probably benign 0.13
Z1176:Kcnj2 UTSW 11 111072135 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCATTGGTGCAGTCATGGCG -3'
(R):5'- TGAGTTGTCATGGCAGTCGC -3'

Sequencing Primer
(F):5'- CAGTCATGGCGAAGATGGC -3'
(R):5'- GCCTTCCAGTATGACAACAATTTC -3'
Posted On2019-11-12