Incidental Mutation 'R7713:Osr1'
ID594746
Institutional Source Beutler Lab
Gene Symbol Osr1
Ensembl Gene ENSMUSG00000048387
Gene Nameodd-skipped related transcription factor 1
SynonymsOdd1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.702) question?
Stock #R7713 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location9570116-9581500 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 9579253 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 42 (Y42F)
Ref Sequence ENSEMBL: ENSMUSP00000055486 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057021] [ENSMUST00000217975]
Predicted Effect probably damaging
Transcript: ENSMUST00000057021
AA Change: Y42F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000055486
Gene: ENSMUSG00000048387
AA Change: Y42F

DomainStartEndE-ValueType
low complexity region 134 151 N/A INTRINSIC
ZnF_C2H2 175 197 1.67e-2 SMART
ZnF_C2H2 203 225 2.4e-3 SMART
ZnF_C2H2 231 253 4.4e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000217975
AA Change: Y42F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted mutation fail to form atrial septum and exhibit dilated atria with hypoplastic venous valves and blood backflow from the heart into systemic veins. Complete agenesis of adrenal glands, metanephric kidneys, gonads, and defects in pericardium formation are also observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik T C 10: 87,230,311 S119P possibly damaging Het
Agtpbp1 T A 13: 59,514,152 I282F probably damaging Het
Armh1 A T 4: 117,214,228 M355K possibly damaging Het
BC067074 T G 13: 113,346,541 V1559G Het
Cep128 A T 12: 91,019,322 D1013E probably benign Het
Clock A T 5: 76,245,420 probably null Het
D630003M21Rik G A 2: 158,216,778 Q401* probably null Het
Dnah17 C A 11: 118,025,171 V4302L probably benign Het
Drc3 A G 11: 60,370,560 Y179C probably benign Het
Erbb3 T C 10: 128,574,449 T647A probably benign Het
Esrp2 T C 8: 106,134,276 T205A probably benign Het
Fbxw7 T C 3: 84,967,565 probably null Het
Fmn1 C T 2: 113,525,814 P965S unknown Het
Fndc7 C T 3: 108,870,663 V412M possibly damaging Het
G2e3 C A 12: 51,369,056 A525E probably damaging Het
Gcfc2 C T 6: 81,941,390 R354C probably damaging Het
Ggt1 T A 10: 75,585,674 N510K probably damaging Het
Gnas C T 2: 174,299,027 T389I unknown Het
Hapln3 C T 7: 79,117,373 R306H probably benign Het
Hydin T C 8: 110,593,812 L4496P possibly damaging Het
Iqgap2 T A 13: 95,731,444 I219L probably benign Het
Kcnj2 T C 11: 111,072,483 S234P probably benign Het
Lipf T A 19: 33,973,065 S286T probably damaging Het
Lrrc32 G T 7: 98,499,338 G442W probably damaging Het
Megf10 GGCAGCAACAGCACCAGCAGCAACAGCACCAGCAGCA GGCAGCAACAGCACCAGCAGCA 18: 57,293,999 probably benign Het
Mtmr4 T C 11: 87,597,724 V68A probably damaging Het
Mug2 T C 6: 122,078,795 S1146P possibly damaging Het
Naa35 T C 13: 59,598,105 I75T probably benign Het
Nepn T A 10: 52,401,178 F337I probably benign Het
Nf1 A G 11: 79,425,606 M496V probably benign Het
Nthl1 A T 17: 24,638,657 I277F possibly damaging Het
Olfr1208 T C 2: 88,897,778 probably benign Het
Olfr518 A C 7: 108,880,682 I308S probably damaging Het
Rad54l2 G A 9: 106,717,223 R369W probably damaging Het
Ryr3 T A 2: 112,635,346 T4828S probably benign Het
Slc25a54 T A 3: 109,102,817 C211S probably damaging Het
Ube4b C T 4: 149,398,781 R10Q possibly damaging Het
Usp9y G A Y: 1,304,411 Q2440* probably null Het
Yars G T 4: 129,210,498 V312L probably benign Het
Zfp26 G A 9: 20,441,334 T145I probably benign Het
Zic5 T C 14: 122,464,113 N402S unknown Het
Other mutations in Osr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Osr1 APN 12 9579432 missense probably benign 0.00
IGL01508:Osr1 APN 12 9579370 missense probably damaging 1.00
IGL02583:Osr1 APN 12 9579675 missense probably damaging 1.00
R0077:Osr1 UTSW 12 9579691 missense probably damaging 1.00
R0218:Osr1 UTSW 12 9579639 missense probably benign 0.09
R1223:Osr1 UTSW 12 9579699 missense probably damaging 1.00
R1568:Osr1 UTSW 12 9579798 splice site probably null
R1924:Osr1 UTSW 12 9579268 missense probably damaging 1.00
R1939:Osr1 UTSW 12 9579687 missense probably damaging 1.00
R5580:Osr1 UTSW 12 9579325 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCTGGAGGAAGGTGACCTACTC -3'
(R):5'- CTGGCTTAGGGTGAATGACG -3'

Sequencing Primer
(F):5'- GGAAGGTGACCTACTCTAAACATCTC -3'
(R):5'- TTAGGGTGAATGACGTGGGGAAAC -3'
Posted On2019-11-12