Incidental Mutation 'R7713:G2e3'
ID594747
Institutional Source Beutler Lab
Gene Symbol G2e3
Ensembl Gene ENSMUSG00000035293
Gene NameG2/M-phase specific E3 ubiquitin ligase
Synonyms6030408C04Rik, D930034K21Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.734) question?
Stock #R7713 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location51348061-51376986 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 51369056 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 525 (A525E)
Ref Sequence ENSEMBL: ENSMUSP00000113270 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054308] [ENSMUST00000119211] [ENSMUST00000121521]
Predicted Effect probably damaging
Transcript: ENSMUST00000054308
AA Change: A502E

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000054474
Gene: ENSMUSG00000035293
AA Change: A502E

DomainStartEndE-ValueType
SCOP:d1bqk__ 2 74 1e-2 SMART
PHD 80 128 5.2e-3 SMART
RING 81 115 5.28e0 SMART
PHD 143 193 3.13e0 SMART
RING 144 192 4.48e-1 SMART
PHD 237 286 1.18e1 SMART
Pfam:HECT 402 692 2.7e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000119211
AA Change: A525E

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113270
Gene: ENSMUSG00000035293
AA Change: A525E

DomainStartEndE-ValueType
SCOP:d1bqk__ 2 74 9e-3 SMART
PHD 80 128 5.2e-3 SMART
RING 81 115 5.28e0 SMART
PHD 143 193 3.13e0 SMART
RING 144 192 4.48e-1 SMART
PHD 237 286 1.18e1 SMART
Pfam:HECT 383 717 3.1e-13 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000121521
AA Change: A408E
SMART Domains Protein: ENSMUSP00000113191
Gene: ENSMUSG00000035293
AA Change: A408E

DomainStartEndE-ValueType
SCOP:d1bqk__ 2 74 9e-3 SMART
PHD 80 128 5.2e-3 SMART
RING 81 115 5.28e0 SMART
PHD 143 193 3.13e0 SMART
RING 144 192 4.48e-1 SMART
PHD 237 286 1.18e1 SMART
Pfam:HECT 298 598 4e-15 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Embryos homozygous for a gene trap allele that inactivates this gene die prior to implantation due to massive apoptosis which results in involution of the blastocyst. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik T C 10: 87,230,311 S119P possibly damaging Het
Agtpbp1 T A 13: 59,514,152 I282F probably damaging Het
Armh1 A T 4: 117,214,228 M355K possibly damaging Het
BC067074 T G 13: 113,346,541 V1559G Het
Cep128 A T 12: 91,019,322 D1013E probably benign Het
Clock A T 5: 76,245,420 probably null Het
D630003M21Rik G A 2: 158,216,778 Q401* probably null Het
Dnah17 C A 11: 118,025,171 V4302L probably benign Het
Drc3 A G 11: 60,370,560 Y179C probably benign Het
Erbb3 T C 10: 128,574,449 T647A probably benign Het
Esrp2 T C 8: 106,134,276 T205A probably benign Het
Fbxw7 T C 3: 84,967,565 probably null Het
Fmn1 C T 2: 113,525,814 P965S unknown Het
Fndc7 C T 3: 108,870,663 V412M possibly damaging Het
Gcfc2 C T 6: 81,941,390 R354C probably damaging Het
Ggt1 T A 10: 75,585,674 N510K probably damaging Het
Gnas C T 2: 174,299,027 T389I unknown Het
Hapln3 C T 7: 79,117,373 R306H probably benign Het
Hydin T C 8: 110,593,812 L4496P possibly damaging Het
Iqgap2 T A 13: 95,731,444 I219L probably benign Het
Kcnj2 T C 11: 111,072,483 S234P probably benign Het
Lipf T A 19: 33,973,065 S286T probably damaging Het
Lrrc32 G T 7: 98,499,338 G442W probably damaging Het
Megf10 GGCAGCAACAGCACCAGCAGCAACAGCACCAGCAGCA GGCAGCAACAGCACCAGCAGCA 18: 57,293,999 probably benign Het
Mtmr4 T C 11: 87,597,724 V68A probably damaging Het
Mug2 T C 6: 122,078,795 S1146P possibly damaging Het
Naa35 T C 13: 59,598,105 I75T probably benign Het
Nepn T A 10: 52,401,178 F337I probably benign Het
Nf1 A G 11: 79,425,606 M496V probably benign Het
Nthl1 A T 17: 24,638,657 I277F possibly damaging Het
Olfr1208 T C 2: 88,897,778 probably benign Het
Olfr518 A C 7: 108,880,682 I308S probably damaging Het
Osr1 A T 12: 9,579,253 Y42F probably damaging Het
Rad54l2 G A 9: 106,717,223 R369W probably damaging Het
Ryr3 T A 2: 112,635,346 T4828S probably benign Het
Slc25a54 T A 3: 109,102,817 C211S probably damaging Het
Ube4b C T 4: 149,398,781 R10Q possibly damaging Het
Usp9y G A Y: 1,304,411 Q2440* probably null Het
Yars G T 4: 129,210,498 V312L probably benign Het
Zfp26 G A 9: 20,441,334 T145I probably benign Het
Zic5 T C 14: 122,464,113 N402S unknown Het
Other mutations in G2e3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00500:G2e3 APN 12 51353798 critical splice acceptor site probably null
IGL00793:G2e3 APN 12 51367762 missense probably benign 0.00
IGL02222:G2e3 APN 12 51363233 missense probably damaging 1.00
IGL02335:G2e3 APN 12 51369158 missense probably benign 0.19
IGL03134:G2e3 APN 12 51364030 intron probably benign
Amadeus UTSW 12 51353789 splice site probably null
R1868:G2e3 UTSW 12 51353629 missense probably benign 0.44
R2060:G2e3 UTSW 12 51372606 missense probably damaging 1.00
R3814:G2e3 UTSW 12 51353661 missense probably benign 0.28
R4355:G2e3 UTSW 12 51365337 missense probably benign 0.00
R4360:G2e3 UTSW 12 51363414 splice site probably benign
R4903:G2e3 UTSW 12 51371630 missense probably benign 0.23
R4966:G2e3 UTSW 12 51371630 missense probably benign 0.23
R4974:G2e3 UTSW 12 51369139 missense probably benign 0.00
R5399:G2e3 UTSW 12 51357194 critical splice donor site probably null
R5406:G2e3 UTSW 12 51372666 missense probably damaging 0.97
R5739:G2e3 UTSW 12 51372504 missense possibly damaging 0.94
R6225:G2e3 UTSW 12 51369136 missense possibly damaging 0.77
R6625:G2e3 UTSW 12 51353789 splice site probably null
R7458:G2e3 UTSW 12 51365507 missense possibly damaging 0.67
R7529:G2e3 UTSW 12 51371604 missense probably damaging 1.00
R7748:G2e3 UTSW 12 51371667 missense probably benign 0.00
R7998:G2e3 UTSW 12 51353841 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CTACCCTGTTTTACTAAAGAATTGAGT -3'
(R):5'- GCTTATTCAGGAGAGGTTAACATTTT -3'

Sequencing Primer
(F):5'- ACTGCATCTAGTGAGTCACG -3'
(R):5'- ACCTCTCAAAAGGTGCCT -3'
Posted On2019-11-12