Incidental Mutation 'R7713:Cep128'
ID594748
Institutional Source Beutler Lab
Gene Symbol Cep128
Ensembl Gene ENSMUSG00000061533
Gene Namecentrosomal protein 128
Synonyms4930534B04Rik, 5430424K18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.218) question?
Stock #R7713 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location90998492-91384409 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 91019322 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 1013 (D1013E)
Ref Sequence ENSEMBL: ENSMUSP00000115679 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000141429] [ENSMUST00000143415]
Predicted Effect probably benign
Transcript: ENSMUST00000141429
AA Change: D1013E

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000115679
Gene: ENSMUSG00000061533
AA Change: D1013E

DomainStartEndE-ValueType
low complexity region 89 110 N/A INTRINSIC
coiled coil region 216 329 N/A INTRINSIC
low complexity region 340 352 N/A INTRINSIC
coiled coil region 377 822 N/A INTRINSIC
coiled coil region 876 960 N/A INTRINSIC
low complexity region 1091 1102 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143415
AA Change: D560E

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000122627
Gene: ENSMUSG00000061533
AA Change: D560E

DomainStartEndE-ValueType
coiled coil region 2 369 N/A INTRINSIC
coiled coil region 423 507 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik T C 10: 87,230,311 S119P possibly damaging Het
Agtpbp1 T A 13: 59,514,152 I282F probably damaging Het
Armh1 A T 4: 117,214,228 M355K possibly damaging Het
BC067074 T G 13: 113,346,541 V1559G Het
Clock A T 5: 76,245,420 probably null Het
D630003M21Rik G A 2: 158,216,778 Q401* probably null Het
Dnah17 C A 11: 118,025,171 V4302L probably benign Het
Drc3 A G 11: 60,370,560 Y179C probably benign Het
Erbb3 T C 10: 128,574,449 T647A probably benign Het
Esrp2 T C 8: 106,134,276 T205A probably benign Het
Fbxw7 T C 3: 84,967,565 probably null Het
Fmn1 C T 2: 113,525,814 P965S unknown Het
Fndc7 C T 3: 108,870,663 V412M possibly damaging Het
G2e3 C A 12: 51,369,056 A525E probably damaging Het
Gcfc2 C T 6: 81,941,390 R354C probably damaging Het
Ggt1 T A 10: 75,585,674 N510K probably damaging Het
Gnas C T 2: 174,299,027 T389I unknown Het
Hapln3 C T 7: 79,117,373 R306H probably benign Het
Hydin T C 8: 110,593,812 L4496P possibly damaging Het
Iqgap2 T A 13: 95,731,444 I219L probably benign Het
Kcnj2 T C 11: 111,072,483 S234P probably benign Het
Lipf T A 19: 33,973,065 S286T probably damaging Het
Lrrc32 G T 7: 98,499,338 G442W probably damaging Het
Megf10 GGCAGCAACAGCACCAGCAGCAACAGCACCAGCAGCA GGCAGCAACAGCACCAGCAGCA 18: 57,293,999 probably benign Het
Mtmr4 T C 11: 87,597,724 V68A probably damaging Het
Mug2 T C 6: 122,078,795 S1146P possibly damaging Het
Naa35 T C 13: 59,598,105 I75T probably benign Het
Nepn T A 10: 52,401,178 F337I probably benign Het
Nf1 A G 11: 79,425,606 M496V probably benign Het
Nthl1 A T 17: 24,638,657 I277F possibly damaging Het
Olfr1208 T C 2: 88,897,778 probably benign Het
Olfr518 A C 7: 108,880,682 I308S probably damaging Het
Osr1 A T 12: 9,579,253 Y42F probably damaging Het
Rad54l2 G A 9: 106,717,223 R369W probably damaging Het
Ryr3 T A 2: 112,635,346 T4828S probably benign Het
Slc25a54 T A 3: 109,102,817 C211S probably damaging Het
Ube4b C T 4: 149,398,781 R10Q possibly damaging Het
Usp9y G A Y: 1,304,411 Q2440* probably null Het
Yars G T 4: 129,210,498 V312L probably benign Het
Zfp26 G A 9: 20,441,334 T145I probably benign Het
Zic5 T C 14: 122,464,113 N402S unknown Het
Other mutations in Cep128
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00673:Cep128 APN 12 91234191 missense probably benign 0.17
IGL00800:Cep128 APN 12 91255664 missense possibly damaging 0.83
IGL01738:Cep128 APN 12 91230842 missense probably damaging 1.00
IGL01844:Cep128 APN 12 91008854 missense probably benign 0.14
IGL01918:Cep128 APN 12 91234210 missense probably damaging 0.99
IGL02043:Cep128 APN 12 91266730 splice site probably benign
IGL02405:Cep128 APN 12 91266986 missense probably benign 0.04
IGL02616:Cep128 APN 12 91296258 missense probably benign 0.03
PIT4260001:Cep128 UTSW 12 91299034 missense probably benign 0.00
R0416:Cep128 UTSW 12 91230867 splice site probably benign
R0442:Cep128 UTSW 12 91266771 missense probably damaging 1.00
R0608:Cep128 UTSW 12 90999535 utr 3 prime probably benign
R1108:Cep128 UTSW 12 91339109 missense probably damaging 1.00
R1178:Cep128 UTSW 12 91260155 missense probably damaging 1.00
R1183:Cep128 UTSW 12 91325598 missense possibly damaging 0.84
R1394:Cep128 UTSW 12 91266980 missense probably benign 0.07
R1395:Cep128 UTSW 12 91266980 missense probably benign 0.07
R1498:Cep128 UTSW 12 91366417 missense probably benign
R1541:Cep128 UTSW 12 91348781 missense probably damaging 1.00
R1639:Cep128 UTSW 12 91366368 missense probably damaging 1.00
R1643:Cep128 UTSW 12 91325532 missense probably damaging 1.00
R1682:Cep128 UTSW 12 91230822 missense probably damaging 0.99
R1739:Cep128 UTSW 12 91022491 splice site probably null
R1758:Cep128 UTSW 12 91347578 missense probably benign 0.02
R1845:Cep128 UTSW 12 91289598 missense probably benign 0.01
R1987:Cep128 UTSW 12 91230829 missense probably benign 0.01
R2017:Cep128 UTSW 12 91366464 missense probably damaging 0.98
R2237:Cep128 UTSW 12 91347567 missense probably benign 0.01
R2239:Cep128 UTSW 12 91347567 missense probably benign 0.01
R3103:Cep128 UTSW 12 91019344 missense probably damaging 0.99
R4552:Cep128 UTSW 12 91294162 missense probably damaging 0.98
R4664:Cep128 UTSW 12 91296253 missense probably damaging 1.00
R4774:Cep128 UTSW 12 91234195 missense probably damaging 0.99
R4838:Cep128 UTSW 12 90999545 utr 3 prime probably benign
R4858:Cep128 UTSW 12 91260162 missense probably benign 0.04
R4924:Cep128 UTSW 12 91022400 splice site silent
R5002:Cep128 UTSW 12 91255723 splice site probably null
R5282:Cep128 UTSW 12 91339119 missense probably damaging 1.00
R5386:Cep128 UTSW 12 90999571 missense probably benign 0.03
R5476:Cep128 UTSW 12 91213618 missense probably damaging 0.96
R5643:Cep128 UTSW 12 91348851 missense probably damaging 1.00
R5644:Cep128 UTSW 12 91348851 missense probably damaging 1.00
R5668:Cep128 UTSW 12 90999636 missense probably benign 0.01
R6057:Cep128 UTSW 12 91296224 missense possibly damaging 0.92
R6831:Cep128 UTSW 12 91266974 missense probably damaging 0.99
R6852:Cep128 UTSW 12 91366342 critical splice donor site probably null
R7078:Cep128 UTSW 12 91234104 missense probably damaging 0.99
R7144:Cep128 UTSW 12 91294159 missense probably damaging 0.98
R7487:Cep128 UTSW 12 90999630 missense probably benign 0.05
R7582:Cep128 UTSW 12 91347566 missense probably damaging 0.96
R8245:Cep128 UTSW 12 90999645 missense probably benign 0.03
Z1177:Cep128 UTSW 12 91289603 missense probably benign 0.02
Z1177:Cep128 UTSW 12 91364371 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATCTTTGCATATGCTTGCGG -3'
(R):5'- ATCCTAATTTCAATCCCTGGTTGG -3'

Sequencing Primer
(F):5'- GCATATGCTTGCGGAATTGAAAAC -3'
(R):5'- CTGGGAATTGAACTCAGGACCTCTG -3'
Posted On2019-11-12