Incidental Mutation 'R7713:Zic5'
ID594753
Institutional Source Beutler Lab
Gene Symbol Zic5
Ensembl Gene ENSMUSG00000041703
Gene Namezinc finger protein of the cerebellum 5
Synonymsodd-paired related, 1700049L20Rik, Opr
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7713 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location122456795-122465677 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 122464113 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 402 (N402S)
Ref Sequence ENSEMBL: ENSMUSP00000035754 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039118]
Predicted Effect unknown
Transcript: ENSMUST00000039118
AA Change: N402S
SMART Domains Protein: ENSMUSP00000035754
Gene: ENSMUSG00000041703
AA Change: N402S

DomainStartEndE-ValueType
low complexity region 13 28 N/A INTRINSIC
low complexity region 116 154 N/A INTRINSIC
low complexity region 160 171 N/A INTRINSIC
low complexity region 182 192 N/A INTRINSIC
low complexity region 200 214 N/A INTRINSIC
low complexity region 284 303 N/A INTRINSIC
low complexity region 309 353 N/A INTRINSIC
ZnF_C2H2 390 408 2.2e2 SMART
ZnF_C2H2 417 444 2.14e0 SMART
ZnF_C2H2 450 474 8.02e-5 SMART
ZnF_C2H2 480 504 2.53e-2 SMART
ZnF_C2H2 510 534 7.49e-5 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ZIC family of C2H2-type zinc finger proteins. Members of this family are important during development, and have been associated X-linked visceral heterotaxy and holoprosencephaly type 5. This gene is closely linked to a gene encoding zinc finger protein of the cerebellum 2, a related family member on chromosome 13. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display postnatal lethality and reduced life spans with exencephaly, abnormal cerebral cortex and diencephalon morphology, abnormal gait and posture, and impaired growth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik T C 10: 87,230,311 S119P possibly damaging Het
Agtpbp1 T A 13: 59,514,152 I282F probably damaging Het
Armh1 A T 4: 117,214,228 M355K possibly damaging Het
BC067074 T G 13: 113,346,541 V1559G Het
Cep128 A T 12: 91,019,322 D1013E probably benign Het
Clock A T 5: 76,245,420 probably null Het
D630003M21Rik G A 2: 158,216,778 Q401* probably null Het
Dnah17 C A 11: 118,025,171 V4302L probably benign Het
Drc3 A G 11: 60,370,560 Y179C probably benign Het
Erbb3 T C 10: 128,574,449 T647A probably benign Het
Esrp2 T C 8: 106,134,276 T205A probably benign Het
Fbxw7 T C 3: 84,967,565 probably null Het
Fmn1 C T 2: 113,525,814 P965S unknown Het
Fndc7 C T 3: 108,870,663 V412M possibly damaging Het
G2e3 C A 12: 51,369,056 A525E probably damaging Het
Gcfc2 C T 6: 81,941,390 R354C probably damaging Het
Ggt1 T A 10: 75,585,674 N510K probably damaging Het
Gnas C T 2: 174,299,027 T389I unknown Het
Hapln3 C T 7: 79,117,373 R306H probably benign Het
Hydin T C 8: 110,593,812 L4496P possibly damaging Het
Iqgap2 T A 13: 95,731,444 I219L probably benign Het
Kcnj2 T C 11: 111,072,483 S234P probably benign Het
Lipf T A 19: 33,973,065 S286T probably damaging Het
Lrrc32 G T 7: 98,499,338 G442W probably damaging Het
Megf10 GGCAGCAACAGCACCAGCAGCAACAGCACCAGCAGCA GGCAGCAACAGCACCAGCAGCA 18: 57,293,999 probably benign Het
Mtmr4 T C 11: 87,597,724 V68A probably damaging Het
Mug2 T C 6: 122,078,795 S1146P possibly damaging Het
Naa35 T C 13: 59,598,105 I75T probably benign Het
Nepn T A 10: 52,401,178 F337I probably benign Het
Nf1 A G 11: 79,425,606 M496V probably benign Het
Nthl1 A T 17: 24,638,657 I277F possibly damaging Het
Olfr1208 T C 2: 88,897,778 probably benign Het
Olfr518 A C 7: 108,880,682 I308S probably damaging Het
Osr1 A T 12: 9,579,253 Y42F probably damaging Het
Rad54l2 G A 9: 106,717,223 R369W probably damaging Het
Ryr3 T A 2: 112,635,346 T4828S probably benign Het
Slc25a54 T A 3: 109,102,817 C211S probably damaging Het
Ube4b C T 4: 149,398,781 R10Q possibly damaging Het
Usp9y G A Y: 1,304,411 Q2440* probably null Het
Yars G T 4: 129,210,498 V312L probably benign Het
Zfp26 G A 9: 20,441,334 T145I probably benign Het
Other mutations in Zic5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02157:Zic5 APN 14 122459512 missense unknown
Ezekiel UTSW 14 122465154 missense unknown
R0227:Zic5 UTSW 14 122459661 missense unknown
R0646:Zic5 UTSW 14 122463939 missense unknown
R1327:Zic5 UTSW 14 122459779 splice site probably benign
R1387:Zic5 UTSW 14 122459485 missense unknown
R1665:Zic5 UTSW 14 122459527 missense unknown
R2020:Zic5 UTSW 14 122464830 missense unknown
R2571:Zic5 UTSW 14 122459478 missense unknown
R4241:Zic5 UTSW 14 122464663 missense probably benign 0.03
R4610:Zic5 UTSW 14 122464800 missense probably damaging 0.98
R4706:Zic5 UTSW 14 122459557 missense unknown
R5496:Zic5 UTSW 14 122459343 missense unknown
R6178:Zic5 UTSW 14 122459336 missense unknown
R6189:Zic5 UTSW 14 122464974 missense unknown
R6332:Zic5 UTSW 14 122459749 missense unknown
R6485:Zic5 UTSW 14 122459640 missense unknown
R6564:Zic5 UTSW 14 122459421 missense unknown
R6677:Zic5 UTSW 14 122465154 missense unknown
R6877:Zic5 UTSW 14 122459688 missense unknown
R6977:Zic5 UTSW 14 122459548 missense unknown
R6977:Zic5 UTSW 14 122459555 small deletion probably benign
R6978:Zic5 UTSW 14 122459548 missense unknown
R6978:Zic5 UTSW 14 122459555 small deletion probably benign
R6996:Zic5 UTSW 14 122464668 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ATCTTGAGGTTCTCGGAGCG -3'
(R):5'- GAGCCGTGAACTTAAACCTGAAC -3'

Sequencing Primer
(F):5'- AGCGCGCGAAGACCTTG -3'
(R):5'- GTGAACTTAAACCTGAACCTGGCTG -3'
Posted On2019-11-12