Incidental Mutation 'R7713:Nthl1'
ID594754
Institutional Source Beutler Lab
Gene Symbol Nthl1
Ensembl Gene ENSMUSG00000041429
Gene Namenth (endonuclease III)-like 1 (E.coli)
SynonymsNth1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7713 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location24632682-24638838 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 24638657 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 277 (I277F)
Ref Sequence ENSEMBL: ENSMUSP00000047413 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002572] [ENSMUST00000019684] [ENSMUST00000047611]
Predicted Effect probably benign
Transcript: ENSMUST00000002572
SMART Domains Protein: ENSMUSP00000002572
Gene: ENSMUSG00000002504

DomainStartEndE-ValueType
PDZ 19 91 6.31e-21 SMART
PDZ 159 231 8.79e-20 SMART
Pfam:EBP50_C 232 284 5.1e-13 PFAM
Pfam:EBP50_C 261 337 2.3e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000019684
SMART Domains Protein: ENSMUSP00000019684
Gene: ENSMUSG00000002504

DomainStartEndE-ValueType
PDZ 48 120 8.79e-20 SMART
Pfam:EBP50_C-term 186 226 2.7e-27 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000047611
AA Change: I277F

PolyPhen 2 Score 0.769 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000047413
Gene: ENSMUSG00000041429
AA Change: I277F

DomainStartEndE-ValueType
low complexity region 9 20 N/A INTRINSIC
low complexity region 24 37 N/A INTRINSIC
low complexity region 55 68 N/A INTRINSIC
ENDO3c 126 276 1.06e-58 SMART
FES 277 297 4.82e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a DNA N-glycosylase of the endonuclease III family. Like a similar protein in E. coli, the encoded protein has DNA glycosylase activity on DNA substrates containing oxidized pyrimidine residues and has apurinic/apyrimidinic lyase activity. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit slower hepatic repair of thymine glycol DNA lesions after treatment with X-rays. Mutants are overtly normal, long-lived, and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik T C 10: 87,230,311 S119P possibly damaging Het
Agtpbp1 T A 13: 59,514,152 I282F probably damaging Het
Armh1 A T 4: 117,214,228 M355K possibly damaging Het
BC067074 T G 13: 113,346,541 V1559G Het
Cep128 A T 12: 91,019,322 D1013E probably benign Het
Clock A T 5: 76,245,420 probably null Het
D630003M21Rik G A 2: 158,216,778 Q401* probably null Het
Dnah17 C A 11: 118,025,171 V4302L probably benign Het
Drc3 A G 11: 60,370,560 Y179C probably benign Het
Erbb3 T C 10: 128,574,449 T647A probably benign Het
Esrp2 T C 8: 106,134,276 T205A probably benign Het
Fbxw7 T C 3: 84,967,565 probably null Het
Fmn1 C T 2: 113,525,814 P965S unknown Het
Fndc7 C T 3: 108,870,663 V412M possibly damaging Het
G2e3 C A 12: 51,369,056 A525E probably damaging Het
Gcfc2 C T 6: 81,941,390 R354C probably damaging Het
Ggt1 T A 10: 75,585,674 N510K probably damaging Het
Gnas C T 2: 174,299,027 T389I unknown Het
Hapln3 C T 7: 79,117,373 R306H probably benign Het
Hydin T C 8: 110,593,812 L4496P possibly damaging Het
Iqgap2 T A 13: 95,731,444 I219L probably benign Het
Kcnj2 T C 11: 111,072,483 S234P probably benign Het
Lipf T A 19: 33,973,065 S286T probably damaging Het
Lrrc32 G T 7: 98,499,338 G442W probably damaging Het
Megf10 GGCAGCAACAGCACCAGCAGCAACAGCACCAGCAGCA GGCAGCAACAGCACCAGCAGCA 18: 57,293,999 probably benign Het
Mtmr4 T C 11: 87,597,724 V68A probably damaging Het
Mug2 T C 6: 122,078,795 S1146P possibly damaging Het
Naa35 T C 13: 59,598,105 I75T probably benign Het
Nepn T A 10: 52,401,178 F337I probably benign Het
Nf1 A G 11: 79,425,606 M496V probably benign Het
Olfr1208 T C 2: 88,897,778 probably benign Het
Olfr518 A C 7: 108,880,682 I308S probably damaging Het
Osr1 A T 12: 9,579,253 Y42F probably damaging Het
Rad54l2 G A 9: 106,717,223 R369W probably damaging Het
Ryr3 T A 2: 112,635,346 T4828S probably benign Het
Slc25a54 T A 3: 109,102,817 C211S probably damaging Het
Ube4b C T 4: 149,398,781 R10Q possibly damaging Het
Usp9y G A Y: 1,304,411 Q2440* probably null Het
Yars G T 4: 129,210,498 V312L probably benign Het
Zfp26 G A 9: 20,441,334 T145I probably benign Het
Zic5 T C 14: 122,464,113 N402S unknown Het
Other mutations in Nthl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01293:Nthl1 APN 17 24638709 missense probably damaging 1.00
IGL01658:Nthl1 APN 17 24634845 missense probably benign 0.02
IGL02573:Nthl1 APN 17 24633975 missense probably benign 0.00
R6295:Nthl1 UTSW 17 24638501 missense probably damaging 1.00
R6722:Nthl1 UTSW 17 24634034 missense probably benign 0.00
R7043:Nthl1 UTSW 17 24638670 missense probably benign 0.30
R7392:Nthl1 UTSW 17 24638624 missense probably benign
R8514:Nthl1 UTSW 17 24634115 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATAGCCAACCGACTGAGGTG -3'
(R):5'- CGGGCCAAGAAATCAACTGTG -3'

Sequencing Primer
(F):5'- CCGACTGAGGTGGACCAAG -3'
(R):5'- GTGAAAAACTTCCCAGGTTTATTGC -3'
Posted On2019-11-12