Incidental Mutation 'R7713:Lipf'
ID594756
Institutional Source Beutler Lab
Gene Symbol Lipf
Ensembl Gene ENSMUSG00000024768
Gene Namelipase, gastric
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.187) question?
Stock #R7713 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location33961187-33976810 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 33973065 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 286 (S286T)
Ref Sequence ENSEMBL: ENSMUSP00000025680 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025680]
Predicted Effect probably damaging
Transcript: ENSMUST00000025680
AA Change: S286T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025680
Gene: ENSMUSG00000024768
AA Change: S286T

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Abhydro_lipase 34 96 2.9e-27 PFAM
Pfam:Abhydrolase_1 77 377 2.3e-26 PFAM
Pfam:Abhydrolase_5 78 372 1.5e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes gastric lipase, an enzyme involved in the digestion of dietary triglycerides in the gastrointestinal tract, and responsible for 30% of fat digestion processes occurring in human. It is secreted by gastric chief cells in the fundic mucosa of the stomach, and it hydrolyzes the ester bonds of triglycerides under acidic pH conditions. The gene is a member of a conserved gene family of lipases that play distinct roles in neutral lipid metabolism. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik T C 10: 87,230,311 S119P possibly damaging Het
Agtpbp1 T A 13: 59,514,152 I282F probably damaging Het
Armh1 A T 4: 117,214,228 M355K possibly damaging Het
BC067074 T G 13: 113,346,541 V1559G Het
Cep128 A T 12: 91,019,322 D1013E probably benign Het
Clock A T 5: 76,245,420 probably null Het
D630003M21Rik G A 2: 158,216,778 Q401* probably null Het
Dnah17 C A 11: 118,025,171 V4302L probably benign Het
Drc3 A G 11: 60,370,560 Y179C probably benign Het
Erbb3 T C 10: 128,574,449 T647A probably benign Het
Esrp2 T C 8: 106,134,276 T205A probably benign Het
Fbxw7 T C 3: 84,967,565 probably null Het
Fmn1 C T 2: 113,525,814 P965S unknown Het
Fndc7 C T 3: 108,870,663 V412M possibly damaging Het
G2e3 C A 12: 51,369,056 A525E probably damaging Het
Gcfc2 C T 6: 81,941,390 R354C probably damaging Het
Ggt1 T A 10: 75,585,674 N510K probably damaging Het
Gnas C T 2: 174,299,027 T389I unknown Het
Hapln3 C T 7: 79,117,373 R306H probably benign Het
Hydin T C 8: 110,593,812 L4496P possibly damaging Het
Iqgap2 T A 13: 95,731,444 I219L probably benign Het
Kcnj2 T C 11: 111,072,483 S234P probably benign Het
Lrrc32 G T 7: 98,499,338 G442W probably damaging Het
Megf10 GGCAGCAACAGCACCAGCAGCAACAGCACCAGCAGCA GGCAGCAACAGCACCAGCAGCA 18: 57,293,999 probably benign Het
Mtmr4 T C 11: 87,597,724 V68A probably damaging Het
Mug2 T C 6: 122,078,795 S1146P possibly damaging Het
Naa35 T C 13: 59,598,105 I75T probably benign Het
Nepn T A 10: 52,401,178 F337I probably benign Het
Nf1 A G 11: 79,425,606 M496V probably benign Het
Nthl1 A T 17: 24,638,657 I277F possibly damaging Het
Olfr1208 T C 2: 88,897,778 probably benign Het
Olfr518 A C 7: 108,880,682 I308S probably damaging Het
Osr1 A T 12: 9,579,253 Y42F probably damaging Het
Rad54l2 G A 9: 106,717,223 R369W probably damaging Het
Ryr3 T A 2: 112,635,346 T4828S probably benign Het
Slc25a54 T A 3: 109,102,817 C211S probably damaging Het
Ube4b C T 4: 149,398,781 R10Q possibly damaging Het
Usp9y G A Y: 1,304,411 Q2440* probably null Het
Yars G T 4: 129,210,498 V312L probably benign Het
Zfp26 G A 9: 20,441,334 T145I probably benign Het
Zic5 T C 14: 122,464,113 N402S unknown Het
Other mutations in Lipf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01902:Lipf APN 19 33970779 missense probably benign 0.33
IGL02024:Lipf APN 19 33976595 missense probably damaging 1.00
R1427:Lipf UTSW 19 33965600 missense probably damaging 1.00
R1454:Lipf UTSW 19 33970732 splice site probably benign
R1484:Lipf UTSW 19 33964780 missense probably benign 0.00
R1636:Lipf UTSW 19 33976535 missense probably damaging 1.00
R1720:Lipf UTSW 19 33965666 nonsense probably null
R1916:Lipf UTSW 19 33965675 missense probably benign 0.07
R2010:Lipf UTSW 19 33973546 missense probably benign
R2519:Lipf UTSW 19 33965525 missense probably damaging 0.99
R2937:Lipf UTSW 19 33973038 missense probably damaging 1.00
R4063:Lipf UTSW 19 33965565 missense probably benign 0.43
R4640:Lipf UTSW 19 33968797 missense probably damaging 0.98
R4671:Lipf UTSW 19 33976676 missense possibly damaging 0.94
R4818:Lipf UTSW 19 33965688 missense probably benign 0.04
R5619:Lipf UTSW 19 33966892 missense possibly damaging 0.95
R6034:Lipf UTSW 19 33964889 missense probably benign
R6034:Lipf UTSW 19 33964889 missense probably benign
R6045:Lipf UTSW 19 33966844 missense probably damaging 1.00
R6464:Lipf UTSW 19 33973544 missense probably benign 0.00
R7502:Lipf UTSW 19 33976606 missense probably damaging 1.00
R7649:Lipf UTSW 19 33965698 missense possibly damaging 0.84
R7714:Lipf UTSW 19 33965648 missense probably damaging 1.00
R8203:Lipf UTSW 19 33966883 missense probably benign 0.00
Z1176:Lipf UTSW 19 33965595 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCATTTAACTGCACTATTCATCC -3'
(R):5'- TAACTAGCCATCTAGGACATATGTGAG -3'

Sequencing Primer
(F):5'- CTTCCATTGACGGTTACCCTGAAAC -3'
(R):5'- CCTTTGTTACTCAAATCACATGTTC -3'
Posted On2019-11-12