Incidental Mutation 'R7714:Dpyd'
ID 594768
Institutional Source Beutler Lab
Gene Symbol Dpyd
Ensembl Gene ENSMUSG00000033308
Gene Name dihydropyrimidine dehydrogenase
Synonyms DPD, E330028L06Rik
MMRRC Submission
Accession Numbers

Genbank: NM_170778; MGI: 2139667

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7714 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 118562129-119432924 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 118804131 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 254 (K254R)
Ref Sequence ENSEMBL: ENSMUSP00000039429 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039177]
AlphaFold Q8CHR6
Predicted Effect probably benign
Transcript: ENSMUST00000039177
AA Change: K254R

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000039429
Gene: ENSMUSG00000033308
AA Change: K254R

DomainStartEndE-ValueType
Pfam:Fer4_20 55 168 4.6e-35 PFAM
Pfam:Pyr_redox_2 188 499 1.5e-15 PFAM
Pfam:NAD_binding_8 193 249 5.5e-8 PFAM
Pfam:DHO_dh 532 838 8.1e-36 PFAM
Pfam:Dus 617 822 7.5e-8 PFAM
Pfam:Fer4_10 945 997 7.4e-9 PFAM
Pfam:Fer4_21 946 1004 1.3e-26 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a pyrimidine catabolic enzyme and the initial and rate-limiting factor in the pathway of uracil and thymidine catabolism. Mutations in this gene result in dihydropyrimidine dehydrogenase deficiency, an error in pyrimidine metabolism associated with thymine-uraciluria and an increased risk of toxicity in cancer patients receiving 5-fluorouracil chemotherapy. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810011H11Rik A G 14: 32,805,172 E32G possibly damaging Het
2010300C02Rik T A 1: 37,624,777 Q680L probably benign Het
Adam22 A G 5: 8,117,587 probably null Het
Agrn C A 4: 156,195,397 D106Y probably damaging Het
Arfgap3 A T 15: 83,308,151 Y416N probably benign Het
Atp6v0a2 C T 5: 124,637,595 T135M probably damaging Het
Bach1 C A 16: 87,718,848 Y92* probably null Het
Catsperg1 A C 7: 29,185,482 C905G probably null Het
Cbr2 T C 11: 120,729,802 I219V probably benign Het
Ccdc3 A T 2: 5,229,097 K244I probably damaging Het
Cd226 T C 18: 89,247,309 V237A probably damaging Het
Chek2 T C 5: 110,841,453 C81R probably benign Het
Col27a1 T C 4: 63,324,486 probably null Het
Crybg3 A T 16: 59,558,873 S673T probably benign Het
Csmd2 T A 4: 128,382,950 Y848* probably null Het
Dgkb C A 12: 38,630,593 T764K probably damaging Het
Dock4 T A 12: 40,725,649 C530* probably null Het
Dstyk C T 1: 132,456,876 P703S possibly damaging Het
Ehhadh A T 16: 21,766,390 I247N probably damaging Het
Fer1l5 T G 1: 36,401,477 L597R probably damaging Het
Fignl1 T C 11: 11,802,842 E71G probably damaging Het
Fnip2 A C 3: 79,518,114 V58G probably damaging Het
Gapdhs A T 7: 30,731,924 I377N probably damaging Het
Gcn1l1 C T 5: 115,595,300 A1059V probably damaging Het
Gm884 T C 11: 103,616,893 I1416M unknown Het
Gpd1 G A 15: 99,722,086 S255N probably damaging Het
Grik2 A C 10: 49,419,696 I392S probably damaging Het
Hoxb3 T C 11: 96,345,780 L228P probably damaging Het
Iws1 A T 18: 32,090,515 M659L probably benign Het
Kmt2c A G 5: 25,375,366 C570R probably benign Het
Lamc3 T A 2: 31,922,267 probably null Het
Lipf G A 19: 33,965,648 G119R probably damaging Het
Magel2 A T 7: 62,378,382 I345L probably benign Het
Mdn1 G A 4: 32,722,360 A2381T possibly damaging Het
Med12l T C 3: 59,093,586 V690A probably benign Het
Megf10 GGCAGCAACAGCACCAGCAGCAACAGCACCAGCAGCA GGCAGCAACAGCACCAGCAGCA 18: 57,293,999 probably benign Het
Mob3b A G 4: 35,083,872 Y106H probably damaging Het
Myo1c T C 11: 75,658,693 Y166H probably damaging Het
Ndst4 A T 3: 125,570,844 H390L probably benign Het
Nt5c1b T A 12: 10,375,472 N280K probably damaging Het
Olfr1471 A T 19: 13,445,888 N292I probably damaging Het
Olfr433 G A 1: 174,042,334 R128H probably benign Het
Otof A G 5: 30,370,253 F1947L probably damaging Het
Pabpc4 G A 4: 123,295,309 A481T probably benign Het
Parm1 C T 5: 91,593,932 T53I possibly damaging Het
Pilra C T 5: 137,835,417 R129Q probably benign Het
Pkd1 C T 17: 24,550,276 A5V unknown Het
Pmch T C 10: 88,091,380 S82P probably benign Het
Prf1 G A 10: 61,300,155 R70H possibly damaging Het
Rad51c T C 11: 87,401,450 S180G probably benign Het
Rassf8 A C 6: 145,815,247 T100P probably damaging Het
Rnpepl1 A G 1: 92,917,168 E394G probably damaging Het
Rufy2 T A 10: 63,002,993 V418E probably benign Het
Sdad1 A T 5: 92,302,679 V199D probably damaging Het
Sptbn4 A T 7: 27,364,336 S2227T probably benign Het
Tac4 A G 11: 95,265,290 M66V probably benign Het
Tas2r126 T C 6: 42,435,097 V188A probably benign Het
Tcerg1 T C 18: 42,560,935 V707A possibly damaging Het
Trav13-4-dv7 G A 14: 53,757,898 G103D probably damaging Het
Trav8d-1 A G 14: 52,778,923 S89G probably benign Het
Ttll4 C T 1: 74,679,413 S141L probably benign Het
Vash1 T C 12: 86,691,840 S354P probably benign Het
Vmn2r40 T A 7: 8,908,117 I726F Het
Vmn2r53 A C 7: 12,606,491 N18K probably damaging Het
Wnt6 T C 1: 74,784,263 F253S probably damaging Het
Zfp599 A G 9: 22,250,515 I118T probably benign Het
Other mutations in Dpyd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Dpyd APN 3 118944242 missense probably damaging 1.00
IGL00508:Dpyd APN 3 119064987 missense probably benign 0.06
IGL02113:Dpyd APN 3 118999219 missense probably benign 0.06
IGL02177:Dpyd APN 3 119064910 missense possibly damaging 0.76
IGL03001:Dpyd APN 3 118917242 missense probably benign 0.07
IGL03106:Dpyd APN 3 119195134 missense probably benign 0.03
IGL03399:Dpyd APN 3 119314777 missense probably damaging 0.98
F5770:Dpyd UTSW 3 118897126 nonsense probably null
F6893:Dpyd UTSW 3 118804134 critical splice donor site probably null
R0014:Dpyd UTSW 3 119141935 missense probably damaging 1.00
R0081:Dpyd UTSW 3 118944255 missense probably benign 0.00
R0267:Dpyd UTSW 3 118917272 missense probably benign
R0349:Dpyd UTSW 3 118917099 nonsense probably null
R0387:Dpyd UTSW 3 119427226 missense probably benign 0.21
R0523:Dpyd UTSW 3 118899203 missense probably benign
R0555:Dpyd UTSW 3 119431542 missense probably damaging 1.00
R0652:Dpyd UTSW 3 119427275 missense probably damaging 1.00
R0741:Dpyd UTSW 3 118674505 missense possibly damaging 0.79
R1313:Dpyd UTSW 3 118899161 splice site probably benign
R1554:Dpyd UTSW 3 119065046 splice site probably null
R1610:Dpyd UTSW 3 119065006 missense probably benign
R1710:Dpyd UTSW 3 118610443 critical splice acceptor site probably null
R1861:Dpyd UTSW 3 118917131 missense probably damaging 1.00
R2103:Dpyd UTSW 3 119064952 missense probably benign 0.02
R2130:Dpyd UTSW 3 118674568 missense probably benign
R2131:Dpyd UTSW 3 118674568 missense probably benign
R2882:Dpyd UTSW 3 119065030 missense probably damaging 0.99
R3771:Dpyd UTSW 3 119412278 critical splice donor site probably null
R3978:Dpyd UTSW 3 118897088 critical splice acceptor site probably benign
R3978:Dpyd UTSW 3 118897089 critical splice acceptor site probably benign
R4030:Dpyd UTSW 3 118897166 missense probably benign 0.03
R4065:Dpyd UTSW 3 118897089 critical splice acceptor site probably benign
R4066:Dpyd UTSW 3 118897089 critical splice acceptor site probably benign
R4234:Dpyd UTSW 3 119431584 missense probably damaging 1.00
R4502:Dpyd UTSW 3 118797537 missense probably damaging 1.00
R4638:Dpyd UTSW 3 119266077 missense probably benign 0.03
R4980:Dpyd UTSW 3 118917118 missense probably damaging 0.99
R5262:Dpyd UTSW 3 118797422 nonsense probably null
R5348:Dpyd UTSW 3 118781943 missense probably benign
R5587:Dpyd UTSW 3 119064951 missense probably damaging 1.00
R5611:Dpyd UTSW 3 119194293 missense probably benign
R5665:Dpyd UTSW 3 118917092 missense probably damaging 1.00
R5716:Dpyd UTSW 3 118899179 missense probably damaging 1.00
R5786:Dpyd UTSW 3 119427237 missense probably damaging 0.97
R6046:Dpyd UTSW 3 119431575 missense probably benign 0.01
R6404:Dpyd UTSW 3 119265957 missense probably benign 0.02
R6703:Dpyd UTSW 3 118897200 splice site probably null
R7037:Dpyd UTSW 3 118899289 missense probably benign 0.00
R7215:Dpyd UTSW 3 119266032 missense probably benign 0.11
R7301:Dpyd UTSW 3 118899284 missense possibly damaging 0.90
R7336:Dpyd UTSW 3 119064921 missense probably damaging 1.00
R8238:Dpyd UTSW 3 119195193 splice site probably null
R8306:Dpyd UTSW 3 119412173 missense probably benign
R8315:Dpyd UTSW 3 119314885 missense probably benign 0.09
R8321:Dpyd UTSW 3 118781924 missense possibly damaging 0.84
R8342:Dpyd UTSW 3 119314803 missense possibly damaging 0.60
R8735:Dpyd UTSW 3 119141916 missense possibly damaging 0.74
R8750:Dpyd UTSW 3 119141936 missense probably damaging 1.00
R8874:Dpyd UTSW 3 118999332 missense probably damaging 1.00
R8910:Dpyd UTSW 3 118610518 missense probably benign 0.17
R8973:Dpyd UTSW 3 119314933 critical splice donor site probably null
R9070:Dpyd UTSW 3 118999243 missense probably damaging 0.98
R9132:Dpyd UTSW 3 118917248 missense probably damaging 1.00
R9198:Dpyd UTSW 3 118759654 critical splice acceptor site probably null
R9260:Dpyd UTSW 3 119314798 missense possibly damaging 0.95
R9307:Dpyd UTSW 3 119314911 missense probably benign
V7581:Dpyd UTSW 3 118897126 nonsense probably null
V7582:Dpyd UTSW 3 118897126 nonsense probably null
V7583:Dpyd UTSW 3 118897126 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTACTCACAGGGGCTTATTTGTC -3'
(R):5'- ATTGCCCTTTTCCAGGCTAG -3'

Sequencing Primer
(F):5'- GTCCCTTTAATGCTGATCAGTAAG -3'
(R):5'- TTCCAGGCTAGTGGCATTCAGAC -3'
Posted On 2019-11-12