Incidental Mutation 'R7714:Ndst4'
ID594769
Institutional Source Beutler Lab
Gene Symbol Ndst4
Ensembl Gene ENSMUSG00000027971
Gene NameN-deacetylase/N-sulfotransferase (heparin glucosaminyl) 4
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R7714 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location125404076-125728899 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 125570844 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 390 (H390L)
Ref Sequence ENSEMBL: ENSMUSP00000133341 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000173932]
Predicted Effect
SMART Domains Protein: ENSMUSP00000120687
Gene: ENSMUSG00000027971
AA Change: H80L

DomainStartEndE-ValueType
Pfam:HSNSD 19 505 1.3e-270 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173932
AA Change: H390L

PolyPhen 2 Score 0.077 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000133341
Gene: ENSMUSG00000027971
AA Change: H390L

DomainStartEndE-ValueType
Pfam:HSNSD 20 505 1.2e-251 PFAM
Pfam:Sulfotransfer_1 594 857 1.2e-43 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit a phenotype restricted to the colonic epithelium that includes an increased number of colon goblet cells, a decreased number of colonocytes, and increased apoptosis of colonic epithelial cells in the proximal colon. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810011H11Rik A G 14: 32,805,172 E32G possibly damaging Het
2010300C02Rik T A 1: 37,624,777 Q680L probably benign Het
Adam22 A G 5: 8,117,587 probably null Het
Agrn C A 4: 156,195,397 D106Y probably damaging Het
Arfgap3 A T 15: 83,308,151 Y416N probably benign Het
Atp6v0a2 C T 5: 124,637,595 T135M probably damaging Het
Bach1 C A 16: 87,718,848 Y92* probably null Het
Catsperg1 A C 7: 29,185,482 C905G probably null Het
Cbr2 T C 11: 120,729,802 I219V probably benign Het
Ccdc3 A T 2: 5,229,097 K244I probably damaging Het
Cd226 T C 18: 89,247,309 V237A probably damaging Het
Chek2 T C 5: 110,841,453 C81R probably benign Het
Col27a1 T C 4: 63,324,486 probably null Het
Crybg3 A T 16: 59,558,873 S673T probably benign Het
Csmd2 T A 4: 128,382,950 Y848* probably null Het
Dgkb C A 12: 38,630,593 T764K probably damaging Het
Dock4 T A 12: 40,725,649 C530* probably null Het
Dpyd A G 3: 118,804,131 K254R probably benign Het
Dstyk C T 1: 132,456,876 P703S possibly damaging Het
Ehhadh A T 16: 21,766,390 I247N probably damaging Het
Fer1l5 T G 1: 36,401,477 L597R probably damaging Het
Fignl1 T C 11: 11,802,842 E71G probably damaging Het
Fnip2 A C 3: 79,518,114 V58G probably damaging Het
Gapdhs A T 7: 30,731,924 I377N probably damaging Het
Gcn1l1 C T 5: 115,595,300 A1059V probably damaging Het
Gm884 T C 11: 103,616,893 I1416M unknown Het
Gpd1 G A 15: 99,722,086 S255N probably damaging Het
Grik2 A C 10: 49,419,696 I392S probably damaging Het
Hoxb3 T C 11: 96,345,780 L228P probably damaging Het
Iws1 A T 18: 32,090,515 M659L probably benign Het
Kmt2c A G 5: 25,375,366 C570R probably benign Het
Lipf G A 19: 33,965,648 G119R probably damaging Het
Magel2 A T 7: 62,378,382 I345L probably benign Het
Mdn1 G A 4: 32,722,360 A2381T possibly damaging Het
Med12l T C 3: 59,093,586 V690A probably benign Het
Megf10 GGCAGCAACAGCACCAGCAGCAACAGCACCAGCAGCA GGCAGCAACAGCACCAGCAGCA 18: 57,293,999 probably benign Het
Mob3b A G 4: 35,083,872 Y106H probably damaging Het
Myo1c T C 11: 75,658,693 Y166H probably damaging Het
Nt5c1b T A 12: 10,375,472 N280K probably damaging Het
Olfr1471 A T 19: 13,445,888 N292I probably damaging Het
Olfr433 G A 1: 174,042,334 R128H probably benign Het
Otof A G 5: 30,370,253 F1947L probably damaging Het
Pabpc4 G A 4: 123,295,309 A481T probably benign Het
Parm1 C T 5: 91,593,932 T53I possibly damaging Het
Pilra C T 5: 137,835,417 R129Q probably benign Het
Pkd1 C T 17: 24,550,276 A5V unknown Het
Pmch T C 10: 88,091,380 S82P probably benign Het
Prf1 G A 10: 61,300,155 R70H possibly damaging Het
Rad51c T C 11: 87,401,450 S180G probably benign Het
Rassf8 A C 6: 145,815,247 T100P probably damaging Het
Rnpepl1 A G 1: 92,917,168 E394G probably damaging Het
Rufy2 T A 10: 63,002,993 V418E probably benign Het
Sdad1 A T 5: 92,302,679 V199D probably damaging Het
Sptbn4 A T 7: 27,364,336 S2227T probably benign Het
Tac4 A G 11: 95,265,290 M66V probably benign Het
Tas2r126 T C 6: 42,435,097 V188A probably benign Het
Tcerg1 T C 18: 42,560,935 V707A possibly damaging Het
Trav13-4-dv7 G A 14: 53,757,898 G103D probably damaging Het
Trav8d-1 A G 14: 52,778,923 S89G probably benign Het
Ttll4 C T 1: 74,679,413 S141L probably benign Het
Vash1 T C 12: 86,691,840 S354P probably benign Het
Vmn2r40 T A 7: 8,908,117 I726F Het
Vmn2r53 A C 7: 12,606,491 N18K probably damaging Het
Wnt6 T C 1: 74,784,263 F253S probably damaging Het
Zfp599 A G 9: 22,250,515 I118T probably benign Het
Other mutations in Ndst4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00920:Ndst4 APN 3 125438211 missense probably damaging 0.98
IGL00926:Ndst4 APN 3 125561453 missense probably benign 0.01
IGL01292:Ndst4 APN 3 125438754 missense probably damaging 1.00
IGL01797:Ndst4 APN 3 125683153 missense probably damaging 0.99
R0004:Ndst4 UTSW 3 125570826 missense probably benign 0.03
R0118:Ndst4 UTSW 3 125611561 nonsense probably null
R0652:Ndst4 UTSW 3 125611539 missense possibly damaging 0.93
R1437:Ndst4 UTSW 3 125561450 missense probably damaging 0.97
R1502:Ndst4 UTSW 3 125437758 start gained probably benign
R1900:Ndst4 UTSW 3 125697895 splice site probably null
R1960:Ndst4 UTSW 3 125438682 nonsense probably null
R2249:Ndst4 UTSW 3 125438174 missense probably benign 0.16
R2334:Ndst4 UTSW 3 125708176 missense possibly damaging 0.86
R2345:Ndst4 UTSW 3 125708120 missense possibly damaging 0.95
R3617:Ndst4 UTSW 3 125438133 missense probably benign 0.00
R3713:Ndst4 UTSW 3 125561505 missense possibly damaging 0.93
R3715:Ndst4 UTSW 3 125561505 missense possibly damaging 0.93
R3954:Ndst4 UTSW 3 125437905 missense probably benign 0.01
R4013:Ndst4 UTSW 3 125683170 missense probably damaging 1.00
R4035:Ndst4 UTSW 3 125438736 missense probably damaging 1.00
R4085:Ndst4 UTSW 3 125609482 missense probably benign
R4496:Ndst4 UTSW 3 125683273 missense probably damaging 1.00
R4498:Ndst4 UTSW 3 125438358 missense probably damaging 1.00
R5187:Ndst4 UTSW 3 125437911 missense probably damaging 0.98
R5233:Ndst4 UTSW 3 125710117 missense probably damaging 1.00
R5518:Ndst4 UTSW 3 125438456 missense probably benign
R5575:Ndst4 UTSW 3 125437830 missense probably benign 0.41
R5687:Ndst4 UTSW 3 125438609 missense possibly damaging 0.79
R5940:Ndst4 UTSW 3 125561419 splice site probably benign
R6027:Ndst4 UTSW 3 125713376 missense probably benign 0.38
R6406:Ndst4 UTSW 3 125438501 missense probably benign
R6540:Ndst4 UTSW 3 125722152 nonsense probably null
R6941:Ndst4 UTSW 3 125609511 missense possibly damaging 0.93
R7108:Ndst4 UTSW 3 125561471 missense probably damaging 0.96
R7269:Ndst4 UTSW 3 125438358 missense probably damaging 1.00
R7278:Ndst4 UTSW 3 125438303 missense probably benign 0.00
R7345:Ndst4 UTSW 3 125714659 missense probably benign 0.07
R7405:Ndst4 UTSW 3 125683216 missense probably benign
R7418:Ndst4 UTSW 3 125708151 missense probably damaging 0.99
R7592:Ndst4 UTSW 3 125570787 missense probably damaging 0.99
R8070:Ndst4 UTSW 3 125714644 missense probably damaging 1.00
X0027:Ndst4 UTSW 3 125437946 missense probably benign
Z1177:Ndst4 UTSW 3 125570740 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GCCCCAGTCTCTGATGTAATG -3'
(R):5'- ATTGGACACGCAGACTTTGTG -3'

Sequencing Primer
(F):5'- GCCCCAGTCTCTGATGTAATGTATAC -3'
(R):5'- AGACTTTGTGTGCCCCGGTAC -3'
Posted On2019-11-12