Incidental Mutation 'R7714:Pabpc4'
ID594773
Institutional Source Beutler Lab
Gene Symbol Pabpc4
Ensembl Gene ENSMUSG00000011257
Gene Namepoly(A) binding protein, cytoplasmic 4
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7714 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location123262351-123298925 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 123295309 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 481 (A481T)
Ref Sequence ENSEMBL: ENSMUSP00000079070 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078734] [ENSMUST00000080178] [ENSMUST00000106241] [ENSMUST00000106243] [ENSMUST00000183940]
Predicted Effect probably benign
Transcript: ENSMUST00000078734
SMART Domains Protein: ENSMUSP00000077794
Gene: ENSMUSG00000011257

DomainStartEndE-ValueType
RRM 12 85 1.47e-21 SMART
RRM 100 171 2.91e-25 SMART
RRM 192 264 1.27e-25 SMART
RRM 295 366 2.54e-25 SMART
low complexity region 478 493 N/A INTRINSIC
low complexity region 503 516 N/A INTRINSIC
PolyA 534 597 4.49e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000080178
AA Change: A481T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000079070
Gene: ENSMUSG00000011257
AA Change: A481T

DomainStartEndE-ValueType
RRM 12 85 1.47e-21 SMART
RRM 100 171 2.91e-25 SMART
RRM 192 264 1.27e-25 SMART
RRM 295 366 2.54e-25 SMART
low complexity region 523 538 N/A INTRINSIC
low complexity region 548 561 N/A INTRINSIC
PolyA 579 642 4.49e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106241
SMART Domains Protein: ENSMUSP00000101848
Gene: ENSMUSG00000011257

DomainStartEndE-ValueType
RRM 12 85 1.47e-21 SMART
RRM 100 171 2.91e-25 SMART
RRM 192 264 1.27e-25 SMART
RRM 295 366 2.54e-25 SMART
low complexity region 507 522 N/A INTRINSIC
low complexity region 532 545 N/A INTRINSIC
PolyA 563 626 4.49e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106243
AA Change: A481T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101850
Gene: ENSMUSG00000011257
AA Change: A481T

DomainStartEndE-ValueType
RRM 12 85 6.2e-24 SMART
RRM 100 171 1.2e-27 SMART
RRM 192 264 5.4e-28 SMART
RRM 295 366 1e-27 SMART
low complexity region 494 509 N/A INTRINSIC
low complexity region 519 532 N/A INTRINSIC
PolyA 550 613 2.1e-43 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183940
SMART Domains Protein: ENSMUSP00000139135
Gene: ENSMUSG00000011257

DomainStartEndE-ValueType
RRM 12 85 1.47e-21 SMART
RRM 100 167 7.64e-20 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Poly(A)-binding proteins (PABPs) bind to the poly(A) tail present at the 3-prime ends of most eukaryotic mRNAs. PABPC4 or IPABP (inducible PABP) was isolated as an activation-induced T-cell mRNA encoding a protein. Activation of T cells increased PABPC4 mRNA levels in T cells approximately 5-fold. PABPC4 contains 4 RNA-binding domains and proline-rich C terminus. PABPC4 is localized primarily to the cytoplasm. It is suggested that PABPC4 might be necessary for regulation of stability of labile mRNA species in activated T cells. PABPC4 was also identified as an antigen, APP1 (activated-platelet protein-1), expressed on thrombin-activated rabbit platelets. PABPC4 may also be involved in the regulation of protein translation in platelets and megakaryocytes or may participate in the binding or stabilization of polyadenylates in platelet dense granules. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810011H11Rik A G 14: 32,805,172 E32G possibly damaging Het
2010300C02Rik T A 1: 37,624,777 Q680L probably benign Het
Adam22 A G 5: 8,117,587 probably null Het
Agrn C A 4: 156,195,397 D106Y probably damaging Het
Arfgap3 A T 15: 83,308,151 Y416N probably benign Het
Atp6v0a2 C T 5: 124,637,595 T135M probably damaging Het
Bach1 C A 16: 87,718,848 Y92* probably null Het
Catsperg1 A C 7: 29,185,482 C905G probably null Het
Cbr2 T C 11: 120,729,802 I219V probably benign Het
Ccdc3 A T 2: 5,229,097 K244I probably damaging Het
Cd226 T C 18: 89,247,309 V237A probably damaging Het
Chek2 T C 5: 110,841,453 C81R probably benign Het
Col27a1 T C 4: 63,324,486 probably null Het
Crybg3 A T 16: 59,558,873 S673T probably benign Het
Csmd2 T A 4: 128,382,950 Y848* probably null Het
Dgkb C A 12: 38,630,593 T764K probably damaging Het
Dock4 T A 12: 40,725,649 C530* probably null Het
Dpyd A G 3: 118,804,131 K254R probably benign Het
Dstyk C T 1: 132,456,876 P703S possibly damaging Het
Ehhadh A T 16: 21,766,390 I247N probably damaging Het
Fer1l5 T G 1: 36,401,477 L597R probably damaging Het
Fignl1 T C 11: 11,802,842 E71G probably damaging Het
Fnip2 A C 3: 79,518,114 V58G probably damaging Het
Gapdhs A T 7: 30,731,924 I377N probably damaging Het
Gcn1l1 C T 5: 115,595,300 A1059V probably damaging Het
Gm884 T C 11: 103,616,893 I1416M unknown Het
Gpd1 G A 15: 99,722,086 S255N probably damaging Het
Grik2 A C 10: 49,419,696 I392S probably damaging Het
Hoxb3 T C 11: 96,345,780 L228P probably damaging Het
Iws1 A T 18: 32,090,515 M659L probably benign Het
Kmt2c A G 5: 25,375,366 C570R probably benign Het
Lipf G A 19: 33,965,648 G119R probably damaging Het
Magel2 A T 7: 62,378,382 I345L probably benign Het
Mdn1 G A 4: 32,722,360 A2381T possibly damaging Het
Med12l T C 3: 59,093,586 V690A probably benign Het
Megf10 GGCAGCAACAGCACCAGCAGCAACAGCACCAGCAGCA GGCAGCAACAGCACCAGCAGCA 18: 57,293,999 probably benign Het
Mob3b A G 4: 35,083,872 Y106H probably damaging Het
Myo1c T C 11: 75,658,693 Y166H probably damaging Het
Ndst4 A T 3: 125,570,844 H390L probably benign Het
Nt5c1b T A 12: 10,375,472 N280K probably damaging Het
Olfr1471 A T 19: 13,445,888 N292I probably damaging Het
Olfr433 G A 1: 174,042,334 R128H probably benign Het
Otof A G 5: 30,370,253 F1947L probably damaging Het
Parm1 C T 5: 91,593,932 T53I possibly damaging Het
Pilra C T 5: 137,835,417 R129Q probably benign Het
Pkd1 C T 17: 24,550,276 A5V unknown Het
Pmch T C 10: 88,091,380 S82P probably benign Het
Prf1 G A 10: 61,300,155 R70H possibly damaging Het
Rad51c T C 11: 87,401,450 S180G probably benign Het
Rassf8 A C 6: 145,815,247 T100P probably damaging Het
Rnpepl1 A G 1: 92,917,168 E394G probably damaging Het
Rufy2 T A 10: 63,002,993 V418E probably benign Het
Sdad1 A T 5: 92,302,679 V199D probably damaging Het
Sptbn4 A T 7: 27,364,336 S2227T probably benign Het
Tac4 A G 11: 95,265,290 M66V probably benign Het
Tas2r126 T C 6: 42,435,097 V188A probably benign Het
Tcerg1 T C 18: 42,560,935 V707A possibly damaging Het
Trav13-4-dv7 G A 14: 53,757,898 G103D probably damaging Het
Trav8d-1 A G 14: 52,778,923 S89G probably benign Het
Ttll4 C T 1: 74,679,413 S141L probably benign Het
Vash1 T C 12: 86,691,840 S354P probably benign Het
Vmn2r40 T A 7: 8,908,117 I726F Het
Vmn2r53 A C 7: 12,606,491 N18K probably damaging Het
Wnt6 T C 1: 74,784,263 F253S probably damaging Het
Zfp599 A G 9: 22,250,515 I118T probably benign Het
Other mutations in Pabpc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Pabpc4 APN 4 123286704 missense probably damaging 1.00
IGL00970:Pabpc4 APN 4 123286815 missense probably damaging 1.00
IGL03093:Pabpc4 APN 4 123286709 missense probably damaging 0.96
R0383:Pabpc4 UTSW 4 123297942 missense probably damaging 1.00
R0924:Pabpc4 UTSW 4 123294665 missense possibly damaging 0.56
R1076:Pabpc4 UTSW 4 123292908 missense possibly damaging 0.74
R1381:Pabpc4 UTSW 4 123289059 missense probably damaging 1.00
R1908:Pabpc4 UTSW 4 123289068 missense possibly damaging 0.68
R1957:Pabpc4 UTSW 4 123286865 missense probably damaging 1.00
R2324:Pabpc4 UTSW 4 123297778 splice site probably benign
R2567:Pabpc4 UTSW 4 123297951 missense probably damaging 1.00
R3768:Pabpc4 UTSW 4 123294612 missense probably damaging 1.00
R4350:Pabpc4 UTSW 4 123290267 missense probably damaging 1.00
R4352:Pabpc4 UTSW 4 123290267 missense probably damaging 1.00
R4353:Pabpc4 UTSW 4 123290267 missense probably damaging 1.00
R5304:Pabpc4 UTSW 4 123290307 missense probably benign 0.43
R5386:Pabpc4 UTSW 4 123294997 missense probably benign 0.15
R5622:Pabpc4 UTSW 4 123291731 critical splice acceptor site probably null
R6853:Pabpc4 UTSW 4 123294743 missense possibly damaging 0.60
R7558:Pabpc4 UTSW 4 123294620 missense possibly damaging 0.94
R7602:Pabpc4 UTSW 4 123292892 missense possibly damaging 0.59
R7631:Pabpc4 UTSW 4 123288970 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGCCTGTCCAGAGTCTGATC -3'
(R):5'- TGAGCGAAACAATGTTCAAAGC -3'

Sequencing Primer
(F):5'- AGAGTCTGATCCACCGGCTAC -3'
(R):5'- CAAGCCAGTGTAGAGCTA -3'
Posted On2019-11-12