Incidental Mutation 'R7714:Csmd2'
ID594774
Institutional Source Beutler Lab
Gene Symbol Csmd2
Ensembl Gene ENSMUSG00000028804
Gene NameCUB and Sushi multiple domains 2
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.152) question?
Stock #R7714 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location127987857-128567656 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 128382950 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 848 (Y848*)
Ref Sequence ENSEMBL: ENSMUSP00000138958 (fasta)
Predicted Effect probably null
Transcript: ENSMUST00000184063
AA Change: Y848*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 97% (63/65)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810011H11Rik A G 14: 32,805,172 E32G possibly damaging Het
2010300C02Rik T A 1: 37,624,777 Q680L probably benign Het
Adam22 A G 5: 8,117,587 probably null Het
Agrn C A 4: 156,195,397 D106Y probably damaging Het
Arfgap3 A T 15: 83,308,151 Y416N probably benign Het
Atp6v0a2 C T 5: 124,637,595 T135M probably damaging Het
Bach1 C A 16: 87,718,848 Y92* probably null Het
Catsperg1 A C 7: 29,185,482 C905G probably null Het
Cbr2 T C 11: 120,729,802 I219V probably benign Het
Ccdc3 A T 2: 5,229,097 K244I probably damaging Het
Cd226 T C 18: 89,247,309 V237A probably damaging Het
Chek2 T C 5: 110,841,453 C81R probably benign Het
Col27a1 T C 4: 63,324,486 probably null Het
Crybg3 A T 16: 59,558,873 S673T probably benign Het
Dgkb C A 12: 38,630,593 T764K probably damaging Het
Dock4 T A 12: 40,725,649 C530* probably null Het
Dpyd A G 3: 118,804,131 K254R probably benign Het
Dstyk C T 1: 132,456,876 P703S possibly damaging Het
Ehhadh A T 16: 21,766,390 I247N probably damaging Het
Fer1l5 T G 1: 36,401,477 L597R probably damaging Het
Fignl1 T C 11: 11,802,842 E71G probably damaging Het
Fnip2 A C 3: 79,518,114 V58G probably damaging Het
Gapdhs A T 7: 30,731,924 I377N probably damaging Het
Gcn1l1 C T 5: 115,595,300 A1059V probably damaging Het
Gm884 T C 11: 103,616,893 I1416M unknown Het
Gpd1 G A 15: 99,722,086 S255N probably damaging Het
Grik2 A C 10: 49,419,696 I392S probably damaging Het
Hoxb3 T C 11: 96,345,780 L228P probably damaging Het
Iws1 A T 18: 32,090,515 M659L probably benign Het
Kmt2c A G 5: 25,375,366 C570R probably benign Het
Lamc3 T A 2: 31,922,267 probably null Het
Lipf G A 19: 33,965,648 G119R probably damaging Het
Magel2 A T 7: 62,378,382 I345L probably benign Het
Mdn1 G A 4: 32,722,360 A2381T possibly damaging Het
Med12l T C 3: 59,093,586 V690A probably benign Het
Megf10 GGCAGCAACAGCACCAGCAGCAACAGCACCAGCAGCA GGCAGCAACAGCACCAGCAGCA 18: 57,293,999 probably benign Het
Mob3b A G 4: 35,083,872 Y106H probably damaging Het
Myo1c T C 11: 75,658,693 Y166H probably damaging Het
Ndst4 A T 3: 125,570,844 H390L probably benign Het
Nt5c1b T A 12: 10,375,472 N280K probably damaging Het
Olfr1471 A T 19: 13,445,888 N292I probably damaging Het
Olfr433 G A 1: 174,042,334 R128H probably benign Het
Otof A G 5: 30,370,253 F1947L probably damaging Het
Pabpc4 G A 4: 123,295,309 A481T probably benign Het
Parm1 C T 5: 91,593,932 T53I possibly damaging Het
Pilra C T 5: 137,835,417 R129Q probably benign Het
Pkd1 C T 17: 24,550,276 A5V unknown Het
Pmch T C 10: 88,091,380 S82P probably benign Het
Prf1 G A 10: 61,300,155 R70H possibly damaging Het
Rad51c T C 11: 87,401,450 S180G probably benign Het
Rassf8 A C 6: 145,815,247 T100P probably damaging Het
Rnpepl1 A G 1: 92,917,168 E394G probably damaging Het
Rufy2 T A 10: 63,002,993 V418E probably benign Het
Sdad1 A T 5: 92,302,679 V199D probably damaging Het
Sptbn4 A T 7: 27,364,336 S2227T probably benign Het
Tac4 A G 11: 95,265,290 M66V probably benign Het
Tas2r126 T C 6: 42,435,097 V188A probably benign Het
Tcerg1 T C 18: 42,560,935 V707A possibly damaging Het
Trav13-4-dv7 G A 14: 53,757,898 G103D probably damaging Het
Trav8d-1 A G 14: 52,778,923 S89G probably benign Het
Ttll4 C T 1: 74,679,413 S141L probably benign Het
Vash1 T C 12: 86,691,840 S354P probably benign Het
Vmn2r40 T A 7: 8,908,117 I726F Het
Vmn2r53 A C 7: 12,606,491 N18K probably damaging Het
Wnt6 T C 1: 74,784,263 F253S probably damaging Het
Zfp599 A G 9: 22,250,515 I118T probably benign Het
Other mutations in Csmd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00519:Csmd2 APN 4 128483473 missense probably benign 0.03
IGL01098:Csmd2 APN 4 128059052 missense probably damaging 0.99
IGL01114:Csmd2 APN 4 128369130 missense probably benign 0.04
IGL01364:Csmd2 APN 4 128414288 missense probably benign 0.01
IGL01530:Csmd2 APN 4 128414301 missense possibly damaging 0.66
IGL01582:Csmd2 APN 4 128563305 nonsense probably null
IGL01670:Csmd2 APN 4 128513371 splice site probably benign
IGL01707:Csmd2 APN 4 128383005 missense possibly damaging 0.81
IGL01810:Csmd2 APN 4 128480845 splice site probably benign
IGL01837:Csmd2 APN 4 128419570 missense possibly damaging 0.92
IGL01924:Csmd2 APN 4 128559947 missense unknown
IGL02013:Csmd2 APN 4 128321323 missense possibly damaging 0.47
IGL02020:Csmd2 APN 4 128559879 missense probably damaging 1.00
IGL02037:Csmd2 APN 4 128477470 splice site probably benign
IGL02303:Csmd2 APN 4 128369008 missense probably benign 0.01
IGL02317:Csmd2 APN 4 128463727 splice site probably benign
IGL02322:Csmd2 APN 4 128463727 splice site probably benign
IGL02338:Csmd2 APN 4 128395066 missense possibly damaging 0.79
IGL02412:Csmd2 APN 4 128513372 splice site probably benign
IGL02428:Csmd2 APN 4 128474816 missense possibly damaging 0.82
IGL02491:Csmd2 APN 4 128534257 missense probably benign
IGL02701:Csmd2 APN 4 128496141 missense probably benign 0.17
IGL02801:Csmd2 APN 4 128552075 splice site probably null
IGL02818:Csmd2 APN 4 128209728 missense probably damaging 1.00
IGL02863:Csmd2 APN 4 128521884 missense probably benign 0.00
IGL02876:Csmd2 APN 4 128321335 nonsense probably null
IGL02977:Csmd2 APN 4 128493276 nonsense probably null
IGL03006:Csmd2 APN 4 128480765 splice site probably benign
IGL03032:Csmd2 APN 4 128519041 missense probably benign 0.03
IGL03148:Csmd2 APN 4 128384269 missense probably damaging 1.00
IGL03157:Csmd2 APN 4 128414299 nonsense probably null
IGL03245:Csmd2 APN 4 128509122 missense probably benign 0.12
IGL03376:Csmd2 APN 4 128517671 missense probably benign 0.03
IGL03014:Csmd2 UTSW 4 128296429 missense probably benign 0.01
R0109:Csmd2 UTSW 4 128544743 missense probably benign 0.03
R0112:Csmd2 UTSW 4 128496029 missense probably damaging 1.00
R0157:Csmd2 UTSW 4 128521911 missense probably benign 0.02
R0390:Csmd2 UTSW 4 128133673 intron probably benign
R0441:Csmd2 UTSW 4 128520230 missense probably benign 0.00
R0519:Csmd2 UTSW 4 128487005 missense possibly damaging 0.95
R0743:Csmd2 UTSW 4 128113676 missense probably benign 0.00
R0746:Csmd2 UTSW 4 128414297 missense probably damaging 1.00
R0973:Csmd2 UTSW 4 128496188 missense possibly damaging 0.91
R1019:Csmd2 UTSW 4 128522014 missense probably benign 0.00
R1476:Csmd2 UTSW 4 128487001 missense probably benign 0.08
R1641:Csmd2 UTSW 4 128483395 missense possibly damaging 0.68
R1709:Csmd2 UTSW 4 128496195 missense probably damaging 0.96
R2866:Csmd2 UTSW 4 128414392 critical splice donor site probably null
R2870:Csmd2 UTSW 4 128557718 missense unknown
R2870:Csmd2 UTSW 4 128557718 missense unknown
R2871:Csmd2 UTSW 4 128557718 missense unknown
R2871:Csmd2 UTSW 4 128557718 missense unknown
R2872:Csmd2 UTSW 4 128557718 missense unknown
R2872:Csmd2 UTSW 4 128557718 missense unknown
R2873:Csmd2 UTSW 4 128557718 missense unknown
R2893:Csmd2 UTSW 4 128538993 intron probably null
R3796:Csmd2 UTSW 4 128517595 missense probably benign 0.20
R3797:Csmd2 UTSW 4 128517595 missense probably benign 0.20
R3798:Csmd2 UTSW 4 128517595 missense probably benign 0.20
R3914:Csmd2 UTSW 4 128321324 missense probably benign 0.07
R4198:Csmd2 UTSW 4 128510924 missense probably benign 0.07
R4489:Csmd2 UTSW 4 128381945 missense possibly damaging 0.68
R4571:Csmd2 UTSW 4 128480095 splice site probably null
R4581:Csmd2 UTSW 4 128369088 missense probably benign 0.02
R4599:Csmd2 UTSW 4 127988128 missense probably benign 0.35
R4649:Csmd2 UTSW 4 128546073 missense probably benign
R4706:Csmd2 UTSW 4 128544751 missense probably benign
R4776:Csmd2 UTSW 4 128442892 missense probably benign 0.09
R4838:Csmd2 UTSW 4 128517749 missense probably benign
R4900:Csmd2 UTSW 4 128452525 missense probably benign 0.03
R4999:Csmd2 UTSW 4 128521930 missense probably benign 0.00
R5024:Csmd2 UTSW 4 128321348 missense possibly damaging 0.94
R5034:Csmd2 UTSW 4 128059108 missense probably damaging 0.98
R5152:Csmd2 UTSW 4 128552035 missense probably benign 0.27
R5172:Csmd2 UTSW 4 128477397 missense probably benign 0.10
R5231:Csmd2 UTSW 4 128546049 missense probably benign 0.00
R5279:Csmd2 UTSW 4 128456914 missense probably benign 0.30
R5287:Csmd2 UTSW 4 128486884 missense probably benign 0.01
R5403:Csmd2 UTSW 4 128486884 missense probably benign 0.01
R5410:Csmd2 UTSW 4 128548819 missense probably benign
R5551:Csmd2 UTSW 4 128510948 missense possibly damaging 0.83
R5566:Csmd2 UTSW 4 128462889 critical splice donor site probably null
R5826:Csmd2 UTSW 4 128519199 splice site probably null
R5907:Csmd2 UTSW 4 128197385 missense probably damaging 0.99
R5913:Csmd2 UTSW 4 128551988 missense probably benign 0.01
R5970:Csmd2 UTSW 4 128546151 missense probably benign 0.00
R5977:Csmd2 UTSW 4 128059034 missense probably damaging 1.00
R6027:Csmd2 UTSW 4 128559946 missense unknown
R6075:Csmd2 UTSW 4 128486865 missense probably benign 0.15
R6129:Csmd2 UTSW 4 128493334 missense possibly damaging 0.79
R6363:Csmd2 UTSW 4 128400379 missense probably benign 0.00
R6366:Csmd2 UTSW 4 128483452 missense probably benign 0.00
R6404:Csmd2 UTSW 4 128521950 missense possibly damaging 0.90
R6437:Csmd2 UTSW 4 127988100 missense probably benign 0.24
R6441:Csmd2 UTSW 4 128394964 missense probably benign 0.03
R6643:Csmd2 UTSW 4 128372597 missense probably benign 0.14
R6724:Csmd2 UTSW 4 128563371 missense probably damaging 0.97
R6734:Csmd2 UTSW 4 128463813 missense probably benign 0.00
R6750:Csmd2 UTSW 4 128197225 missense possibly damaging 0.91
R6801:Csmd2 UTSW 4 128383950 missense probably benign 0.11
R6842:Csmd2 UTSW 4 128509159 missense possibly damaging 0.72
R6843:Csmd2 UTSW 4 128463794 missense probably benign 0.27
R6868:Csmd2 UTSW 4 128442840 missense probably benign
R6882:Csmd2 UTSW 4 128449269 missense probably benign 0.01
R7019:Csmd2 UTSW 4 128369063 missense
R7028:Csmd2 UTSW 4 128277228 missense
R7096:Csmd2 UTSW 4 128462726 missense
R7122:Csmd2 UTSW 4 128449227 missense
R7125:Csmd2 UTSW 4 128496162 missense
R7197:Csmd2 UTSW 4 128511033 missense
R7234:Csmd2 UTSW 4 128456779 missense
R7299:Csmd2 UTSW 4 128528262 missense
R7301:Csmd2 UTSW 4 128528262 missense
R7319:Csmd2 UTSW 4 128393679 missense
R7331:Csmd2 UTSW 4 128564228 splice site probably null
R7332:Csmd2 UTSW 4 128419567 missense
R7352:Csmd2 UTSW 4 128557636 missense
R7402:Csmd2 UTSW 4 128322095 missense
R7402:Csmd2 UTSW 4 128322096 missense
R7474:Csmd2 UTSW 4 128546127 missense
R7555:Csmd2 UTSW 4 128452458 missense
R7592:Csmd2 UTSW 4 128463798 missense
R7700:Csmd2 UTSW 4 128545756 intron probably null
R7734:Csmd2 UTSW 4 128552057 missense
R7735:Csmd2 UTSW 4 128456930 critical splice donor site probably null
R7757:Csmd2 UTSW 4 128483456 missense
R7805:Csmd2 UTSW 4 128419573 missense
R7823:Csmd2 UTSW 4 128209905 missense
R7904:Csmd2 UTSW 4 128419553 missense
R7946:Csmd2 UTSW 4 128520265 missense
R7964:Csmd2 UTSW 4 128523510 missense
R7968:Csmd2 UTSW 4 128197325 missense
R8003:Csmd2 UTSW 4 128539187 nonsense probably null
R8071:Csmd2 UTSW 4 128393538 missense
Z1177:Csmd2 UTSW 4 128530797 missense
Predicted Primers PCR Primer
(F):5'- GAGAGGATTGCAAGTGTACATCC -3'
(R):5'- GAGACTCACTCTCATAGCGGAG -3'

Sequencing Primer
(F):5'- AGTCGAGTTAAATGCACTAGAGG -3'
(R):5'- AGCTGAAAGCCGATGTCTG -3'
Posted On2019-11-12